The following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the mRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter UUU UCU UAU Tyr Phe UGU Сys UUC U UCC UAC UAA STOP UAG STOP UGG| Trp UGC UGA STOP Ser UUA UCA Leu UUG UCG CUU CỤC CCU ССС CCA CAU CAC CAA CGU CGC CGA His Leu Pro Arg CUA Gln CUG CCG CAG CGG AUU ACU AAU AAC AAA AGU lle AUC Asn Ser ACC ACA ACG AGC AGA AGG Thr AUA AUG Lys Arg Met AAG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC GUA GUG Val Ala GCA GCG GAA |Glu GAG GGG Third letter UCAG DCAG DCAG First letter

The following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the mRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter UUU UCU UAU Tyr Phe UGU Сys UUC U UCC UAC UAA STOP UAG STOP UGG| Trp UGC UGA STOP Ser UUA UCA Leu UUG UCG CUU CỤC CCU ССС CCA CAU CAC CAA CGU CGC CGA His Leu Pro Arg CUA Gln CUG CCG CAG CGG AUU ACU AAU AAC AAA AGU lle AUC Asn Ser ACC ACA ACG AGC AGA AGG Thr AUA AUG Lys Arg Met AAG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC GUA GUG Val Ala GCA GCG GAA |Glu GAG GGG Third letter UCAG DCAG DCAG First letter

Name: The following sequence is the coding strand of a piece of DNA. Type o
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following sequence is the coding strand of a piece of DNA. Type out the correspondingtemplate strand of DNA and the MRNA that could be made from this piece of DNA if you assumethat transcription begins at the first nucleotide listed. Next, use t

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOP
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Ser
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct sequence of mRNA transcribed from this DNA template? ATGCGA UACGCU AUGCGA TACGCT
What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’