Answered: Transposons in bacterial genomes can…

Name: Transposons in bacterial genomes can carry genes,including those confe
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Transposons in bacterial genomes can carry genes,including those conferring ________ resistance

Science

Biology

Transposons in bacterial genomes can carry genes,including those conferring ________ resistance

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 24CTQ: Provide a brief summary of the Sanger sequencing method.

See similar textbooks

Related questions

Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…

A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…

Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?

Q: What are frameshift mutations with an example

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: Why isn’t cDNA synthetic

A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…

Q: What do you mean by lysozyme gene?

A: Lysozyme gene is a protein coding gene.

Q: Difference between red-labelled and green-labelled cDNA preparations.

A: Difference between red-labelled and green-labelled cDNA preparations.

Q: 45. Why are topoisomerase inhibitors excellent drugs? How is it possible to use agents that block…

A: Topoisomerases are nuclear enzymes which participate in DNA supercoiling (overwinding or unwinding).…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: ⦁ Original: ATTTGAGCC Mutated: ATTGAGCC. This is an example of what kind of mutation?

A: The alteration, damage, or change in the gene of DNA occurs which can change the genetic information…

Q: occur as a result of biotransformation

A: The process of chemically changing the compounds inside the body from one compound to a different…

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: how to identify mutant genes molecularly bytransformation

A: Transformation is the horizontal gene transfer by which some bacteria can take up foreign genetic…

Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…

A: Original Sequence: GGC TAC ATG GAAMutated Sequence: GGC TAA TGG AA

Q: Could you please explain to me what the following terms mean; “methylase”, “methylates” and…

A: Methylase: it is an enzyme that causes methylation, addition of methy group (CH3) on the substrate.…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: _____ Mutants Are Useful in ______ the Order in Which Proteins Function.

A: Saccharomyces cerevisiaes, or baker’s yeasts, unicellular fungi are useful in understanding genetics…

Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4 codons that specify the amino acid valine, demonstrating the genetic code is…

Q: In your own words, explain the term transposon tagging.

A: Transposons or jumping genes are the sequences of DNA that are able to change their position within…

Q: ATCGTCA AGGCCTA ATCTCAA AGGCCT A Original Strand Mutant Strand Types of Mutation Explain/Why

A: Mutation:- Any alteration in the sequence of DNA that results in altered function or non-functional…

Q: What are some limitations in the use of ASOs for exon-skipping therapies in Duchenne muscular…

A: Duchenne Muscular Dystrophy (DMD) is a muscular disease caused by mutations in the dystrophin gene…

Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!

A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both.…

Q: 30) In the CRISPR system, the targeted DNA sequence is

A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

Q: Question 50 The presence of non-Watson base pair

A: A DNA repair mechanism is a group of processes that helps to correct the faulty or damaged DNA. This…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: 29. siRNA involves in: Gene degenaration Gene downregulation

A: Small interfering RNAs (siRNAs) are 20- 27 base pairs long double-stranded RNA molecules. It is a…

Q: EF-Tu: EF-Ts as ORF-1:RF2 eEF1A:eEF1B O Shine-Dalgarno:5'-7mG O Co-translation: post-translational…

Q: Make me frameshift mutation

A: Any heritable alterations to the DNA sequence are known as mutations. Nucleotide substitution…

Q: Budding yeasts such as S. cerevisiae exhibit telomerase activity throughout their life cycles,…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: How many subunits does the E. coli DNA polymerase I have? Soloct onot

A: Option(d) 1

Q: EboV from Guinea pig Reference DNA Sample mRNA Protein

A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…

Q: Finding the Disease-Causing Mutation in Nic Volker’s Genome

A: Answer: Introduction: Young child Nicolas Volker failed to gain weight. Doctors at Wisconsin…

Q: TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that…

A: Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…

Q: Site-directed mutagenesis of enzyme active site explained

A: Oligonucleotides are generally either DNA or RNA. The length of these is 15-30 nucleotides. The use…

Q: 62 The lagging strand is indicated by c 3' 5' a 9. 5' d 3' C e f a 5' 3' 3' 5' Select an answer and…

A: DNA replication is the process by which new DNA is synthesized from the old DNA molecule by…

Q: What effect does the transposon have on the function of gene X in this figure?

A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…

Q: What would you expect the functional properties of a riboswitch specific for the amino acid lysine…

A: Riboswitch is a gene sequence present on mRNA, which regulates the protein synthesis by binding to a…

Q: Would love a list of different types of nucleotide repeat disorders.

A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…

Q: 50. Explain the Ribonuclease Experiment and why it was important.

A: Proteins are composed of polypeptides. Polypeptides are polymers of amino acids linked with each…

Q: Select two primers from the list below that would exclusively amplify exon 3 in

A: Polymerase chain reaction was developed by Karry Mullis . It utilizes the ability of DNA to make…

Q: How many RNA primers are need for the leading

A: The act of copying a cell's DNA, or DNA replication, is no easy task. Your genome contains…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction: Mutations are changes in the genetic material or character of an organism. It can…

Q: 32. Why is it necessary to modify the RNA molecule?

A: RNA modification affects the activity, localization as well as stability of RNAs. It occurs in all…

Q: 36. Non-sense mutation results to the formation of a shorter protein than what should be…

A: In a nonsense mutation, or stop mutation, there is a change in DNA sequence that causes a…

Q: hat is the delta variant

A: The Delta variant is presently the foremost distinguished strain of COVID-19, however the Lambda…

Q: Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.

A: Sickle cell anemia is the result of a point mutation in the hemoglobin gene. Sickle cell hemoglobin…

Q: Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is…

A: ddNTPs result in termination of the DNA strand because ddNTPs lack the 3'-OH group required for…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Transposons in bacterial genomes can carry genes,
including those conferring ________ resistance

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

cDNA labeled with Cy5 dye-Red cDNA labeled with Cy3 dye-Green
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
What does BCR ABL stand for?
ATTTGAGCC- OriginalATTGAGCC - Mutated The example above is an example of a Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshift
A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
Provide a brief summary of the Sanger sequencing method.
Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does this treatment work? Explain what occurs at the molecular level.
In cancerous cells, CpG islands are: where intercalating agents are found demethylated methylated
Transcribe the DNA sequence from HbA mRNA: nucleotides: ACGTU
What is the translated sequence
Please make this as SIMPLE as possible Question: regarding to horizontal gene transfer please only discuss what cells are still alive or dead between transformation, trasnduction, and conjugation Be specific when discussing the donor versus recipient cell, and if the donor and recipient cells are still alive after each horizontal gene transfer event is complete
Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'