TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACTWrite the amino acid sequence of the protein that would be formed by translating thisplece of DNA. You can use the three letter abbreviations for the amino acid in eachbox, do not use the name of the full amino acids, Use the abbrevlation of the aminoadid exactly as Itswritten in the table (including the appropriate capltalizationsFor example it your answer for amino acid 1 is"Methionine" you would write MET in the box (notMet or met)Second LaterUUUUUUCPhe UCUUAUSer UACUAAUAGTyrUGUCys ULeu UCAucGUGCStop uGA BeopUUGStep UGGTrp GCuuC cuCCUACUGCULeu CocCCACGCAUProcGuCACCAACAGHisCGC ArgCGACGG1st3rdletterAUUA AUGAUAAUGACUleAAUAACAGUACCAsnSer U leBerACCACAMct ACGTheAAAAAGACALysAGGArgacuVal GCCGCAGCGGAUGACGAAGAGGOUGGCGGAGGGArpG GUCGUAGUGAlaGlyGluSeovence of the protein,1st amino acid.2nd arnino acid:3rd amino acid:4th amino acidSth amino acid:6th amino acid:7th amino acid.

Here DNA sequence is given is TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT This DNA strand work as a template…

TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this piece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids. Use the abbrevlation of the amino add exactly as INs written in the table (including the appropriate capitalizations For example, it your answer for amino acid 1 is "Methionine" you would write MET in the box (not Met or met) Becond Letter A Phe UCU UGU Cys U UUU UUUC UUA UUG UAU UAC UAA UAG Tyr UGC Stop UGA Stop A Stop UGG Trp G Ser Leu UCA UCG CCU Leu cc CCA CCG CGU CGC Arg His CUU C CUC CUA CUG CAU Pro CAC CAA CAG CGA CG 1st Gin 3rd Asa AGU Ser u leneer ACC letter ACU ACC AAU AUU A AUC AUA AUG ile ACA Met ACG Thr AAC AAA AGA Lys AGG Arg AAG GAU GAC GAA GAG GOU GGC GGA GGG GCU Asp GUU G GUC GUA GUG Val GCC GCA Ala Gly Glu GCG Sequence of the protein: 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid: Sth amino acid: 6th amino acid: 7th amino acid:

TNIS IS the SC TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this piece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids. Use the abbrevlation of the amino add exactly as INs written in the table (including the appropriate capitalizations For example, it your answer for amino acid 1 is "Methionine" you would write MET in the box (not Met or met) Becond Letter A Phe UCU UGU Cys U UUU UUUC UUA UUG UAU UAC UAA UAG Tyr UGC Stop UGA Stop A Stop UGG Trp G Ser Leu UCA UCG CCU Leu cc CCA CCG CGU CGC Arg His CUU C CUC CUA CUG CAU Pro CAC CAA CAG CGA CG 1st Gin 3rd Asa AGU Ser u leneer ACC letter ACU ACC AAU AUU A AUC AUA AUG ile ACA Met ACG Thr AAC AAA AGA Lys AGG Arg AAG GAU GAC GAA GAG GOU GGC GGA GGG GCU Asp GUU G GUC GUA GUG Val GCC GCA Ala Gly Glu GCG Sequence of the protein: 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid: Sth amino acid: 6th amino acid: 7th amino acid:

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2VQ

See similar textbooks