TRUE OR FALSE: a) DNA replication requires the participation of at least 8 nucleoside triphosphates. b) In order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or loops one strand so both strands can do 5' to 3' synthesis.

TRUE OR FALSE: a) DNA replication requires the participation of at least 8 nucleoside triphosphates. b) In order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or loops one strand so both strands can do 5' to 3' synthesis.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Related questions

Q: Saponification is a process by which triacylglycerols are hydrolyzed to produce glycerol and fatty…

A: Triglycerides have a glycerol backbone with the hydroxyl groups esterified with fatty acids.

Q: Q2: What is the theoretical oxygen demand of sucrose 1.25 g/L solution? Write down the…

A: Theoretical oxygen demand : It is abbreviated as TOD. It is defined as the calculated amount of the…

Q: Which of the following are responsible for removing introns from RNAS in eukaryotes? Major…

A: RNA splicing : It removes the interrupting, non-coding sequences of the genes (introns) from…

Q: How many types of histone proteins are present in eukaryotic chromatin? 3

A: In the nucleus of eukaryotic cells, histones are highly basic proteins with a lot of lysine and…

Q: Reset Help The protein appears to have regions that are closely associated with the region between…

A: TAL effectors are transcription factors secreted by bacterial pathogens. They are virulence factors…

Q: H3N- CH-C CH-CH3 CH2 CH3

A: The net charge on an amino acid is determined by the pKa of the ionizable groups on the amino acid.

Q: In which of the following pairs Is the first eleme than the second? (1 Point) O 0, P O Cs, Rb O I,…

A: Electronegativity - It is property of an atom in a molecule. The tendency of an atom to attract the…

Q: • What happens to the functionality of a denatured enzyme? • How can that result be explained with…

A: Enzymes are biological machines that may catalyze certain processes in the cell. Enzymes catalyze…

Q: 7. What is represented in the following diagram? Pyruvate Lactate Acetyl-coA dehydrogenase…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: (a) Q1 a. Justify why the base thyamine is prefered over guanine in DNA while the reverse is…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: Yeast fermentation is of a value in making baked products due to the release of: Select one: O a.…

A: Fermentation occurs in the yeast in anaerobic conditions. Alcoholic fermentation occurs in the…

Q: What term is typically used to describe gene systems that respond to the supply of a required…

A: These terms are generally used in operon models. An operon is a unit of bacterial gene expression…

Q: D. Lactate

A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…

Q: What term is used to describe the DNA sequence to which a repressor binds? attenuator operator…

A: Operator : DNA sequence that allows proteins responsible for transcription to attach to the DNA…

Q: Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? • What happens to…

A: The gastric juice comprises of water, mucus, hydrochloric acid, pepsin, and intrinsic factor and…

Q: DNA ligases cannot join the sticky ends of two DNA fragments. True False

A: The DNA ligases are used in the process of cloning in which pieces of DNA having matching ends are…

Q: Which among the following The colored solution formed as a positive result for the Biuret test is…

A: A polypeptide chain has amino acids linked together by a peptide backbone.

Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…

A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.

Q: 4. Read the absorbance at 595nm of the blank and test solutions. Calculate the protein concentration…

A: Bradford method of protein assay: This is a method used for determination of concentration of…

Q: Name the complexes of the ETC, electron donor, and determine the number of H+ ions that are pumped…

A: Electron transport chain and chemiosmosis are part of oxidative phosphorylation. Oxidative…

Q: What are the different applications of Gel Electrophoresis?

A: The variation in size and charge of distinct molecules in a sample is exploited by the gel…

Q: In which type of segregation, genetic information is gained? Alternate Adjacent Both None

A: Principle of Segregation genes explains how pairs of gene variants are separated into reproductive…

Q: Briefly describe the primary structure of collagen, a- keratin and B-keratin.

A: Proteins are biomolecules and macromolecules that are made up of one or more long chains of amino…

Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…

A: The equation for the oxidation of glucose is:

Q: Calculate the overall ΔG° (report up to two decimal places) for the net reaction (see attached…

A: Standard free energy change is the Gibb's free energy at 273k temperature and 1 atm pressure ∆G°=…

Q: What is the purpose of acrylamide and bis-acrylamide? in SDS-Page Gel

A: Sodium dodecyl sulphate-Polyacrylamide gel electrophoresis (SDS-PAGE) is a common analytical…

Q: rans configuration) (3) linoleic (18:2) (4) stearic (18:0) (5) palmitic (16:0) 5 >…

A: The melting point of fatty acid was influenced by the degree and length of the hydrocarbon chain.…

Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…

A: The activity of many proteins are modulated by post-translational modification of the proteins.

Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…

A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…

Q: Draw the monosaccharide that results when structure I is treated with HNO3. Is th resulting product…

A: Carbohydrates contain multiple stereocenters and hence many isomers are possible.

Q: In 3 sentences, explain this. Discuss the difference between an ⍺-D-glucose and a β-D-glucose.…

A: Carbohydrates act as the primary energy source for most of the organisms present on earth.…

Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond…

A: The αα-helix is an ordered secondary conformation of proteins. An αα-helix is stabilized by the…

Q: Biological waxes are composed of ____________________. glycerol and only one fatty acid…

A: Waxes are a class of lipids and are important from physiological perspective.

Q: Introduction to campylobacter spp.

A: Bacteria are a key component of cellular life on Earth, and they may be found anywhere from the tops…

Q: In the space below, draw the structural diagram of the molecule that hexokinase phosphorylates into…

A: Glycolysis is a metabolic mechanism and anaerobic energy source found in practically all living…

Q: Explain the roles of transamination, oxidative deamination and the urea cycle in amino acid…

A: Transamination and deamination are two very important processes of amino acid degradation. The…

Q: 2. What are the names of the 3 different isomerase enzymes that appear in glycolysis, and write them…

A: Glycolysis is a metabolic pathway in which glucose is break down into two pyruvate in several steps…

Q: Explain the meaning of metabolic interconversion

A: Metabolism is the body's cells is used for changing the food into energy. The human bodies need this…

Q: Outline the role of amino acids as precursors of other nitrogen-containing compounds in the cell,…

A: Amino acids have a major role to form nitrogen-containing compounds in the cells. As an example,…

Q: Polymerase chain reaction cannot amplify complete circular plasmids. True False

A: Polymerase chain reaction or PCR is a technique which is used to amplify a sample of DNA and is one…

Q: Are proteins and enzyme the same in its structure and function. Why? Explain and provide an example…

A: Introduction: The human body contains a number of cells that perform various functions with the help…

Q: Match the blood glucose source with its fate/outcome.…

A: Blood sugar which is also known as glucose is described as one of the crucial as well as major sugar…

Q: n circulatory system, one the main function of our blood is controlling our body temperature.…

A: Blood is one of the connective tissues that absorbs and distributes heat throughout the body.

Q: Which of the following is a transition mutation? OG --> T G --> A G --> C

Q: Match the following structural composition with the corresponding polysaccharide Linear homoglycan…

A: Polysaccharides may be homopolysaccharides (contain a single type of monomer) or…

Q: What is the name of the predominant amadori molecule product in the binding of hemoglobin and…

A: Excess glucose can react nonenzymatically with the amino groups of intracellular and extracellular…

Q: In size exclusion chromatography, which component will elute last in the set up? O Small proteins…

A: Size exclusion chromatography is a process of separation of molecules based on their size.…

Q: What is the name of proteins that hold DNA in coils or V shapes in Bacteria?

A: SMC : SMC is structural chromosome maintenance .These complexes belongs to the family of ATPases…

Q: 3. Which of the following is false? a) Methyl, phosphoryl, adenyl, uridylyl and adenosine…

A: Enzymes are basically proteins that are intricately packed within with the help of intramolecular…

Q: The residual end of a pre-mRNA transcript is digested by the following enzyme

A: Transcription is the process of formation of pre-mRNA (precursor mRNA) (heterogenous mRNA) from the…

Question

1. TRUE OR FALSE:

a) DNA replication requires the participation of at least 8 nucleoside triphosphates.

b) In order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or loops one strand so both strands can do 5' to 3' synthesis.

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The problem of replicating the lagging strand—that is, adding bases in the 3’ to 5’ direction—is solved by DNA through the use of (a) base pairing (b) replication forks (c) helicase (d) Okazaki fragments (e) topoisomerase
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
Why is the replication of DNA referred to as a semiconservative process? What is the experimental evidence for the semiconservative nature of the process? What experimental results would you expect if replication of DNA were a conservative process?
The smallpox virus, which actually has a fairly large genome size for a virus (about 190,000 base pairs), must use which of the following enzymes to replicate its nucleic acid? A. DNA-dependent-DNA-polymerase B. RNA-dependent-DNA-polymerase C. DNA-dependent-RNA-polymerase D. RNA-dependent-RNA-polymerase E. reverse transcriptase
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as starting points B. methylated lipids as start points C. acetylated lipids as start points D. single stranded sequences as starting points
The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
Name an important difference in the replication of circular DNA versus linear double-stranded DNA.
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide