D. Lactate
Q: Which of the following is NOT true regarding nicotine? a. its psychoactive effects include…
A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…
Q: Using a 1 cm cuvette, the absorbance at 260nm of your double-stranded DNA sample is 0.15. What is…
A: Lambert-Beer's law can be used to calculate the concentration of DNA in a sample. It states that the…
Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…
Q: CASE STUDY # 2 A 2-year-old black girl is being seen by the hematologist after her pediatrician…
A: The red blood cells (RBCs) are the most important blood cells. They are in charge of transporting…
Q: A physician diagnoses an infant patient with a pyruvate carboxylase deficiency in part by measuring…
A: In case of Pyruvate Carboxylase deficiency, body accumulates lactic acid in blood. This is an…
Q: please name and characterize the enzym class according to the given rraction C=O 0. CH ČH-OH C=O Ó.…
A: The given molecule is fructose-1,6-bisphosphate which is broken down to glyceraldehyde-3-phosphate…
Q: why all amino acids except glycine have L and D forms and specify the type of isomerization…
A: Amino acids are the monomeric units of proteins. The general structure of an amino acid has a…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: Glycolysis is a major metabolic pathway in the breakdown of carbohydrates such as glucose.…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a. First…
A: Glycolysis is a metabolic pathway which converts glucose into pyruvate.
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Does SARS-CoV-2 conform to the central dogma of molecular biology that was coined by Francis Crick?…
A: Introduction: SARS-Cov-2 is a member of a large family of viruses called coronavirus disease 19…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…
A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…
Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…
A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: The initiation stage in translation starts with the binding of some initiation factors with the…
Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…
A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: Why is it agreeable from a food safety point of view to keep soy sauce in your cupboard and not the…
A: Soy sauce is produced by the fermentation of soyabeans, grains, and brine using molds- Aspergillus…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: how allosteric regulation is fundamentally different from competitive/uncompetitive/mixed inhibition…
A: Some categories of enzymes exhibit kinetic properties that cannot be studied using Michaelis-Menten…
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: 9. It is noted recurrent vomiting, weakness, sleepiness, and convulsive attacks, as well, in…
A: The ureotelic organisms are the organisms, which convert the ammonia formed through protein…
Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…
A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a.…
A: Glycolysis is a metabolism of glucose (six carbon molecule) into three carbon molecule (pyruvate)…
Q: 10. Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…
A: Parkinson's disease is commonly seen in adults after the age of 50. Parkinson's disease is known to…
Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D.…
A: Introduction: Corticosteroids are steroid hormones that are synthesized in the adrenal cortex. It is…
Q: 5. Compare and constrast the energy content of fats, carbohydrates and proteins.
A: Carbohydrates, proteins and fats are three major form of biomolecules found in living beings. These…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: The inborn error in metabolism occur due to mutation in a gene of the metabolic pathway.
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. Coenzyme b.…
A: The non-protein factors that are necessary for activity of some enzymes are called cofactors.
Q: Morphine (give structure) and en receptor. How is that possible?
A: Antagonist are the drugs that plays an important role in blocking opiods without activating them by…
Q: 6. When a concentrated alkali solution acts on the purine cycle, it breaks down: A. Ester group B.…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: How many FADH2 and NADH molecules get produced by beta oxidation of palmitic acid (a 16 carbon fatty…
A: Beta oxidation is a process of breakdown of fatty acid molecules by breaking the bond between beta…
Q: How is Pyruvate Kinase Deficiency (PKD) inherited? What gene is responsible for the expression of…
A: Pyruvate kinase is an enzyme that regulates cell metabolism by catalysing the conversion of…
Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: Why are they so designated? Ketone bodies are so named because they contain the ketone functional…
A: Ketone bodies are produced by the liver during caloric restriction.
Q: CH,O-P-o C=O 0. CH,O-P-o- CH-OH C=O Ó. HO-C-H H-C-OH H-C-OH O C-H of ČH;O-P-0- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: 5- Draw structure of products in the following metabolic reactions and name the enzyr involved and…
A: Introduction: The drug metabolism is needed to convert non-polar lipophilic compounds into polar…
Q: While fatty acids are most often formed by the condensation of_-carbon units, isoprenoids are…
A: Fatty acid and isoprenoid both are class of lipid and plays an important role in the metabolism of…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: Which among the following The colored solution formed as a positive result for the Biuret test is…
A: A polypeptide chain has amino acids linked together by a peptide backbone.
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: v Vitamin E A. diminished intestinal absorption of lipids v Vitamin K B. night blindness v Vitamin A…
A: Vitamin are organic chemical compounds that are not synthesised by our body. They are required in…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Please I need both Question 21ldentify the tissue that makes the sentence false.Ketones can be measured in theO UrineO BreathO HairO BloodQuestion 22Which exercise type uses oxygen during energy metabolism and allows for long term duration?O. aerobicO. anaerobicO all of these use oxygen for long-term exerciseO. phosphocreatineQuestion: Compare and contrast the complications/consequences of hypo/hyperglycemia. (Can you also include nursing actions/interventions for hypo/hyperglycemia?) I understand this may take longer than 30 minutes to answer, I just need someone to break it down for me. Glucose regulation is hard for me to wrap my head around for Med-Surg. Is this question asking about DKA and HHS? HELP, my test is Monday. thank you!Question 29 options: If 6 molecules of acetyl CoA were completely oxidized by the CAC, how many molecules of FADH2 would be produced?
- I am needing help with problems 1 and 3, please. Thank you. 1) Yeast uses anaerobic respiration. If yeast utilized aerobic respiration, would the balloons have inflated faster or slower? Why? 2) Glycolysis in an anaerobic environment produces a net of 2 ATP and Pyruvate. Why does Yeast bother to ferment Pyruvate to Ethanol? Also, what do you think would happen if yeast DID NOT ferment pyruvate to ethanol? 3) Glycolysis in an aerobic environment leads to the production of many more ATP biomolecules. Briefly describe the additional steps necessary to harvest more energy from glucose breakdown. Include the step where Oxygen is used, since it is the key factor that determines the amount of ATP produced.Question: Please help me explain why tubes 1 and 3 showed evidence of unhydrolyzed strach after 30 minutes. Procedure and data sheet are already givenPlease state if the statements are true or false. 1. Erythrulose is a ketopentose2. The conversion of 1 mole of malate to 1 mole oxaloacetate produces 1 mole of NADH
- Please answer yes or no and give a short explanation. Thank you 1. The rate of glycolysis and glycogenolysis is controlled by phosphofructokinase. 2. Glycogen in the muscles falls with the formation of glucose-6-phosphate. 3. Is the process of anaerobic glycolysis accompanied by accumulation of NADH (H +)?HIGH SCHOOL BIOLOGY QUESTION - please provide a junior/senior high school level response. Please do not copy answers from another website/source. DCCD (diocyclohexylcarbodiimide) inhibits oxidative phosphorylation when the substrate is mitochondrial NADH. DCCD is a drug that binds to ATP synthase and blocks proton transport through the ion channel. a) Breifly explain what the consequences of DCCD on cellular energy production are. b) Suggest at least one other cellular effect of DCCD and briefly explain this effect.Please answer true or false and give explanation. Thank you 4. The coenzyme of monoamine oxidases (MAO) is FAD. 5. Decarboxylation of amino acids is an irreversible process. 6. Does histamine have a vasoconstrictive effect?
- Please help with this problem One of the consequences of ethanol addiction is fatty liver disease, an illness in which liver cells accumulate large amounts of triacylglycerols, the esters derived from glycerol and fatty acids. Ethanol is oxidized in the cytoplasm of liver cells by alcohol dehydrogenase and aldehyde dehydrogenase to yield acetate and 2 NADH. Acetate is then transported into the mitochondrion, where it is converted to acetyl-CoA and metabolized in the citric acid cycle. C. How would excess G6P concentration contribute to the reducing potential required for fatty acid synthesis? Excess G6P usually means that glycolysis is not occurring and NADH is not being used up. D. How does acetate stimulate the rate of citrate formation based on enzyme kinetic? E. How would the concentration of citrate in the mitochondria increase if the rate of isocitrate dehydrogenase rate were inhibited5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but intermediates above pyruvate in the glycolytic pathway build up slowing the pathway. Which of the following products may not be made in the appropriate amounts in the RBC because of the deficiency of pyruvate? A.Glucose B.Oxaloacetate C.acetyl-CoA D.Lactate Explanation for answer in no. 5: 6.In the RBCS of the patient described above, which of the following would be expected? A.ADP to ATP ratios would be elevated above normal. B.NADP+ would increase relative to NADPH. C.Ribulose 5-phosphate levels would decrease. D.NADH to NAD+ ratios would decrease. E.Methemoglobin levels would increaseLong explanations are not needed. Direct answers would suffice. a. Transketolases catalyze two-carbon fragment transfer from sedoheptulose-7-phosphate to xylose-5-phosphate. i. True ii. False b. High concentration of NADPH increases the rate of the pentose phosphate pathway by stimulating glucose-6-phosphate dehydrogenase. i. True ii. False