true or false: The final product(s) of purine catabolism are excreted as urea
Q: po Which of the following non-covalent interactions is the driving force in the initial…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: In animal tissues, the ratio of active, unphosphorylated to inactive, phosphorylated pyruvate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Maargerines made from plant oils are healthier, since they are hydrogenated for spreadability?…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…
A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…
Q: Glucagon causes production of which activates Insulin causes production of which activates -
A: Glucagon and insulin are hormones released from alpha and bets cells of pancreas, respectively.…
Q: In extracellular proteins the amino acid Cys can interact with another Cys to form a bond sometimes…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: how to make 100ml of TBST buffer from 1X TBS (tris buffered saline solution) and 0.1% tween-20
A: X refers to fold concentration of a sample. It means the number of times the standard or stock is…
Q: name this reaction
A: The catabolic process of glycolysis is performed by almost every living cell. Glycolysis is the…
Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…
A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…
Q: . Mucic Acid Test for Galactose and Lactose
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: Kinetic Parameters of Enzyme-Catalyzed Reactions TABLE 12-1 The Values of KM, Keat, and Keat/KM for…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: Wobble hypothesis indicates that: a. fatty acids are degraded 2 carbons at a time. O b.…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Which of the following liver metabolic pathways are not normally active at the same time but are…
A: Cortisol : This is steroid hormone that increases blood glucose levels. it decreases glucose uptake…
Q: Glucose 6-phosphate is fed to a cell line capable of utilizing the pentose phosphate pathway and…
A: There is constant interplay between the Pentose Phosphate Pathway (PPP) and Gluconeogenesis. The…
Q: Virtually all animal cells have a Na+/K+ pump. Which of the following statements concerning it is…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Biological waxes are all: A) trimesters of glycerol and three long chain saturated fatty acids. B)…
A: Introduction: Lipids are hydrophobic molecules that are composed of carbon, oxygen, and hydrogen.…
Q: Which of the following amino acid side chains CANNOT form hydrogen bond? O a. Gln O b. Tyr O C. O d.…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: 3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and…
A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…
Q: Acetyl CoA carboxylase is the major control point for fatty acid synthesis. Which of the following…
A: Acetyl CoA carboxylase catalyzes the carboxylation of acetyl-CoA to produce malonyl-CoA. It is the…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: answer question 2 please asap
A: Polymerase chain reaction (PCR) can amplify a single target DNA fragment from a complex mixture of…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…
Q: 1. Determine the Michaelis-Menten parameters of Vmax and K for the reaction S+E E.S₂E+S E.S E.S+W…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Please draw 2 diastereomer of the following molecule
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Isomers are…
Q: Which of the following statements concerning fatty acid oxidation is NOT true? O b. Fatty-acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: The oxidized form of NADH is O NADH+ O NAD+ O NADOH O NADH2 -
A: Metabolism involves the use of many redox reactions. In redox reactions, electrons can either reduce…
Q: CH2OH 바 조 он г 어 H CH2OH ㅇ 애 1 에 Beta-Derunopyranose KH H+ H2M осH2он 애 애 애 alpha- D- erunopyrunose
A: Alpha and beta forms of monosaccharide sugars are called anomers. The two forms are isomers and…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: If the following monosaccharide underwent cyclization to form a furanose, which of the following is…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: human cannot digest stachyose. Why?isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: Insulin release from a pancreatic ß cell occurs when enters the cell, causing granules filled with…
A: Insulin is a peptide hormone that is essential for maintaining the blood sugar levels. it helps in…
Q: Considering that 21.8 kJ/mole of energy is required to transport 1 H+ across the mitochondrial…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: Which of the following statements concerning insulin is NOT true? a. Insulin can increase glycogen…
A: Glycolysis is the metabolic process that breaks down glucose into pyruvate. Gluconeogenesis if the…
Q: Show the structure of each intermediate in the conversion of b-hydroxybutyryl-ACP to butyryl-ACP by…
A: De novo fatty acid synthesis is also called as Lynen's spiral is a set of reactions catalysed by a…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Q10.1: Answer the following three-part question. a) Calculate the ΔEº’ for the citrate cycle…
A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…
Q: When an inhibitor blocks a step in electron transport, all of the following are true except that Oa.…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: A gene for albumin has 5 exons. When the DNA from this gene is allowed to hybridize with nuclear…
A: Introduction DNA is a self replicating molecule. mRNA is formed from DNA by a process called…
Q: when v=vmax/2,Km =(S) 1.why??Need Explaination. What is V and what is Vmax?how is their relationship…
A: In Michael's menton kinetics, Enzymes are known to show Vmax at a particular concentration of…
true or false: The final product(s) of purine catabolism are excreted as urea
Step by step
Solved in 2 steps
- Saponification is a process by which triacylglycerols are hydrolyzed to produce glycerol and fatty acid salt by the action of a strong acid. True FalseTrue or False If a person intakes a large amount of water-soluble vitamins, the excess vitamins will be stored in liver for later use.Some tumors of the adrenal cortex secrete excess aldosterone and may cause paralysis. Explain this effect andidentify the electrolyte and fluid imbalances you wouldexpect to observe in such a case
- True or false: When food comes in contact with chemosensilum on a house fly, the neurotransmitter/hormone serotonin is released into the hemolymph which stimulate the salivary glands to produce saliva.True or false sodium potassium and chloride are filtered out of the blood into the renal tubular then selectively re-absorbed into the bloodstream to carefully regulate blood volumeHyperphosphatemia is found in diabetes mellitus and starvation, justify this statement. (Subject: Clinical biochemistry)