Which of the following amino acid side chains CANNOT form hydrogen bond? O a. Gln O b. Tyr O C. O d. Asn e. Pro Thr
Q: How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: 1 starting with datp and dctp draw the synthesis of d(ac) dinucleotide. 2 draw the guanine…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: Identify which of the following pairs of amino acid residues can have hydrogen bonding between their…
A: Amino acids are the building blocks of proteins. The structure of protein is maintained by many non…
Q: Acetyl CoA carboxylase is the major control point for fatty acid synthesis. Which of the following…
A: Acetyl CoA carboxylase catalyzes the carboxylation of acetyl-CoA to produce malonyl-CoA. It is the…
Q: What are the components of cephalins? Glycerol Two fatty acids Phosphoric acid Serine All of the…
A: Lipids are a very important class of biological molecule. Lipids can be classified into 2…
Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?
A: Placebo-controlled drug study is a study done where one group of participants are given the actual…
Q: Find 3 reactions that facilitate the synthesis of oxaloacetate
A: The tricarboxylic acid cycle (TCA) is the metabolic pathway that generates NADH and FADH2 for…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: (a) 2,3-Bisphosphoglycerate (BPG) reduces binding of O₂ to hemoglobin from almost hyperbolic to…
A: Hb is a protein responsible for carrying both O2 and CO2 in blood. 1 Hb protein is composed of 4…
Q: Calculate the mass of invertase (in mg) and concentration of invertase (in mM) contained in a…
A: Enzyme Activity =Amount of product formedtime The conventional unit used for assigning enzyme…
Q: Q3
A: Citric acid cycle : It is a metabolic pathway that converts carbon atoms to CO2 and, in doing so,…
Q: n oil obtained from salmon is unusual in that all three fatty acid components are identical. The…
A: Introduction Lipid is one of the important biomolecule in our body. Lipid is present in the plasma…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: 4. If a non-science person asks you what protein folding is and how the concept is related to…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes that…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: What are the Essential and Non-Essential Amino Acids? Describe each.
A: An amino acid is an organic compound that contains both an amino (-NH2) and carboxylic acid (-COOH)…
Q: human cannot digest stachyose. Why?isn‘t it true that human do have aplpha galactosidase to break…
A: Some carbohydrates cannot be broken down in the small intestine by human enzymes. Raffinose and…
Q: Draw the structure of alanylserine, a dipeptide made from alanine and serine, as it would appear at…
A: A dipeptide has two amino acid residues. Amino acid sequences are written with N-terminal amino…
Q: Determine whether each event occurs during initiation, elongation, or termination. Initiation…
A: During translation, mRNA is translated into amino acid sequence. Translation occurs in three steps:…
Q: Structure and Function of Pyruvate Dehydrogenase Q10.2: What is the metabolic logic regarding…
A: Pyruvate dehydrogenase kinase (PDK): It is a kinase enzyme that phosphorylates the enzyme pyruvate…
Q: What is the molecular basis for the difference in the electrophorentic pattern between normal…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: 21. _____________________________________ adds acyl groups to two carbons of the backbone of…
A: Triacylglycerol (TAG) are compounds which has 3 acyl groups attached to a glycerol molecule. Fatty…
Q: Why are steps 4 and 5 essential to the operation of the PDH complex? They catalyze the synthesis of…
A: Pyruvate dehydrogenase (PDH) complex oxidizes pyruvate to acetyl-CoA and carbon dioxide. It happens…
Q: . Mucic Acid Test for Galactose and Lactose
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: xplain the answer to this following question. Why does linolenic acid have the lowest melting point?…
A: Fatty acids (FA) are simplest lipids which is comprised of carboxylic acid with long hydrocarbon…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: CH3C(double bond with O)COO- (aq) + H2O(l)⇌ Pyruvate, a product of glucose metabolism Express your…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: what is the mechanism by organophospahtes inbibit enymes?
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Glucose and fructose are monosaccharides. Glucose is an aldose sugar and fructose is a ketose sugar.…
Q: Describe the biochemical mechanism by which RNA splicing occurs precisely at the exon-intron borders…
A: One notable difference between prokaryotic genes and eukaryotic genes is that prokaryotic genes do…
Q: 3- True or False: A given reaction, such as the hydrolysis of ATP can do a set amount of…
A: Adenosine triphosphate, or ATP, is a small molecule. It can be viewed as the primary energy currency…
Q: At pH 7, the most predominant interaction between glucuronic acid (structure seen below) and the…
A: Electrostatic interactions are the interactions that might be attractive or repulsive that form…
Q: One of the molecules listed below is effective in reducing O2 affinity of human Hb in the absence of…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: How many ATPs are generated in the reaction: Glucose to oxidation to 2 acetyl CoA via Glycerol…
A: A redox reaction is where oxidation and reduction occur simultaneously. In glycolysis, there is a…
Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…
A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…
Q: Which of the following statements concerning D-glucose in INCORRECT? O a. It is a monosaccharide. O…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: How does the degree of unsaturation and structure of fats affect its functionality, for example in…
A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…
Q: A mixture of lipids containing phosphatidic acid, cholesterol, testosterone, phosphatidylserine, and…
A: Non-polar molecules do not form a hydrogen bond with water can are thus considered hydrophobic.…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…
Q: In this age of COVID-19, hand washing is very important. Describe the nature of a surfactant, and…
A: INTRODUCTION : Surfactant : They are molecules which are amphiphilic in nature, which means that…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: An in vitro experiment used the isotope 14C-acetyl-CoA to identify 14C- oxaloacetate (OAA) as the…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: when v=vmax/2,Km =(S) 1.why??Need Explaination. What is V and what is Vmax?how is their relationship…
A: In Michael's menton kinetics, Enzymes are known to show Vmax at a particular concentration of…
Q: Mannose is the C-2 epimer of glucose. Altrose is the C-3 epimer of mannose. Which of the following…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose.…
A: Glucokinase is the enzyme that catalyses the phosphorylation of glucose in hepatocytes. It occurs…
Step by step
Solved in 2 steps with 5 images
- Explain what happens if even one amino acid is substituted for another in a polypeptide chain. Provide a specific example.Which of these are considered “part” of each amino acid? A. Carboxyl acid group B. All of the options are correct C. R Group D. Amino groupWhich of these are NOT components of an amino acid? hydrophilic tail b. side chain c. carboxyl group d. a hydrogen atom e. central carbon atom
- Which of the following group(s) can be found in both an amino acid and a protein? a. Rgroup (side chain) only b. Free amino group and carboxyl group c. Free amino group, free carboxyl group and R groups d. Carbonyl group and free amino group and R groupsThe chemical differences between one amino acid and another isdue to which of the following?a. amino group b. carboxyl groupc. R group d. peptide bond e. carbon atomsWhich part of the amino acid varies between different types of amino acids? A. The amino group B. The carboxyl group C. The side chain D. All of the above
- Which of the following pairs of amino acids can form hydrogen bonds between their side-chain groups? Draw the pairs that can hydrogen bond through their side chains and indicate the hydrogen bonds.(a) Phe, Thr (b) Asn, Ser (c) Thr, Tyr (d) Gly, TrpIn order for proteins to function properly the neccessary amino acids must have a specific what? A. Sequence B. Bond C. Number D. CompoundWhich of the following is formed by the linking of two amino acids?a. a peptide bondb. a functional groupc. quaternary structured. an ionic bond
- What determines the characteristics of an amino acid? Group of answer choices the identity of its side chain its molecular weight both a and b neither a nor bThe β-Sheet is formed mainly by a. hydrophobic interaction b. hydrogen bonding between the peptide bond and water c. hydrogen bonding between two strands d. hydrogen bonding of the side chains e. disulfide bondingPeptide bonding between amino acids in a polypeptide is an example of which type of chemical bonding? a) electrostatic b) covalent c) ionic d) hydrogen