Tumor cells from a person with leukemia have been analyzed to determine which oncogene is involved in the transformation. After partial sequencing of the gene, the predicted gene product is identified as a tyrosine kinase. Which of the following proteins would most likely be encoded by an oncogene and exhibit tyrosine kinase activity? A. Nuclear transcriptional activator B. Epidermal growth factor C. Membrane-associated G protein D. Platelet-derived growth factor E. Growth factor receptor

Tumor cells from a person with leukemia have been analyzed to determine which oncogene is involved in the transformation. After partial sequencing of the gene, the predicted gene product is identified as a tyrosine kinase. Which of the following proteins would most likely be encoded by an oncogene and exhibit tyrosine kinase activity? A. Nuclear transcriptional activator B. Epidermal growth factor C. Membrane-associated G protein D. Platelet-derived growth factor E. Growth factor receptor

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 8TYU: Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription...

See similar textbooks

Similar questions

ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM protein
Which of the following defects in RAS would be tumorigenic? multiple answers A. Deletion of nucleotide binding domain B. Inactivation of Guanine Exchange Factor (GEF) C. Mutation at amino acid 61 that prevents hydrolysis of bound GTP D. Inactivation of GTPase Protein (GAPS) E. Mutation that prevents binding of GTP
While investigating the function of a specific growth factor receptor gene from humans, researchers found that two types of proteins are synthesized from this gene. A larger protein containing a membrane spanning domain recognizes growth factors at the cell surface, stimulating a specific downstream signaling pathway. In contrast, a related, smaller protein is secreted from the cell and binds available growth factor circulating in the blood, thus inhibiting the downstream signaling pathway. Speculate on how the cell synthesizes these disparate proteins.
Which ONE of the following is TRUE concerning the so‐called Philadelphia chromosome? Select one: A.It results in loss of BCR serine‐threonine kinase activity B.It leads to generation of a fusion protein with constitutively active tyrosine kinase activity C.It results from a t(8;21) translocation D.Overexpression of the ABL1 gene results from a translocation that brings a strong gene promoter close to the ABL1 gene
A researcher has identified a mutant strain of yeast whose histones are unable to be acetylated. Which of the following is the MOST reasonable prediction for how the phenotype of this mutant yeast will differ from the phenotype of yeast cells with acetylated histones? A. The mutant will grow more rapidly. B. The mutant will grow much more slowly. C. The mutant will show decreased levels of gene expression. D. The mutant will show increased levels of gene expression.
Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription of heterochromatin (c) produce related but different proteins in different tissues (d) amplify genes to meet the requirement of high levels of a gene product (e) bind transcription factors to enhancers to activate transcription
Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are three different mechanisms that turn off the expression of genes and gene products. Which of these three mechanisms will be most effective in each of the following situations? A. Shutting down the synthesis of a polypeptide B. Shutting down the synthesis of mRNA C. Shutting off the function of a protein For your answers to parts A–C that list more than one mechanism, which mechanism will be the fastest or the most efficient?
What is a second messenger? What are two second messengers that are involved in signaling pathways downstream of GPCRs and explain how they are produced? long answer: If you wanted to compare a cardiac muscle cell with a skeletal muscle, how could you use RNA sequencing to identify genes that are differentially expressed? In your answer, explain this technique and describe what type of information you can learn from it. If RNA sequencing led to the identification of two genes, gene X and gene Y, what are two experiments you could do to study the functions of these two genes?
Intitial analysis of a human colon cancer tumor indicates mutations/defects in APC, B-Raf and p53. Which of the genes below is also most likely mutated in this tumor (select one)? A. Beta-catenin B. K-RAS C. SMAD4 D. MDM2 E. p14 ARF
For each of the following situations, provide a plausible explanation for how it could lead to unrestricted cell division.(a) Colon cancer cells often contain mutations in the gene encoding the prostaglandin E2 receptor. PGE2 is a growth factor required for the division of cells in the gastrointestinal tract.(b) Kaposi sarcoma, a common tumor in people with untreated AIDS, is caused by a virus carrying a gene for a protein similar to the chemokine receptors CXCR1 and CXCR2. Chemokines are cell-specific growth factors.(c) Adenovirus, a tumor virus, carries a gene for the protein E1A, which binds to the retinoblastoma protein, pRb. (d) An important feature of many oncogenes and tumor suppressor genes is their celltype specificity. For example, mutations in the PGE2 receptor are not typically found in lung tumors. Explain this observation. (Note that PGE2 acts through a GPCR in the plasma membrane.)
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Which of the following is an explanation for how there can be differential gene expression throughout a multicellular organism? A) There are unique sets of genes present in the different tissues of the organisms B) Some tissues have histones, while other cells do not use histones C) There are unique combinations of transcription factors in different tissues of the organism D) Different tissues throughout the organism use different genetic coding rules .