Two different types of cell and were broken up using ultrasound and their contents analysed. Both types of cell contained small circular DNA, The circular DNA from all carried the same base sequence, but those from Qwere of two types, with different base sequences. moyetec What may be concluded about the identity of cell types P and Q? P Q heart muscle fibres root cortical cells lymphocytes oinar. mature replood pells contaminated by bacteria mature red blood cells phloem sieve tube element root cortical cells leaf mesophyll cells плотрицх tochaudy BRA.

Two different types of cell and were broken up using ultrasound and their contents analysed. Both types of cell contained small circular DNA, The circular DNA from all carried the same base sequence, but those from Qwere of two types, with different base sequences. moyetec What may be concluded about the identity of cell types P and Q? P Q heart muscle fibres root cortical cells lymphocytes oinar. mature replood pells contaminated by bacteria mature red blood cells phloem sieve tube element root cortical cells leaf mesophyll cells плотрицх tochaudy BRA.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

A small fraction—2 to 3%—of all cancers, acrossmany subtypes, displays a quite remarkable phenome-non: tens to hundreds of rearrangements that primarilyinvolve a single chromosome, or chromosomal region.The breakpoints can be tightly clustered, with several in afew kilobases; the junctions of the rearrangements ofteninvolve segments of DNA that were not originally closetogether on the chromosome. The copy number of varioussegments within the rearranged chromosome was foundto be either zero, indicating deletion, or one, indicatingretention.You can imagine two ways in which such multi-ple, localized rearrangements might happen: a progressiverearrangements model with ongoing inversions, deletions,and duplications involving a localized area, or a cata-strophic model in which the chromosome is shattered intofragments that are stitched back together in random orderby nonhomologous end joining (Figure Q20–2).A. Which of the two models in Figure Q20–2 accountsmore readily for the features of…
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and thosethat relocate DNA regions (inversions and translocations).
Organism Tissue % Adenine % Guanine % Cytosine % Thymine Yeast 31.3 18.7 17.1 32.9 Sea urchin Blood cells 32.8 17.7 18.4 32.1 Rat Bone marrow 28.6 21.4 21.5 28.4 Human Thymus 30.9 19.9 19.8 29.4 Human White blood cells 30.3 19.5 19.9 30.3 Compare the composition of the DNA in the different organisms. Describe any similarities or differences you observe.
A segment of DNA has the following sequence:TTGGATGCTGAACCTACGACA. What would the sequence be immediately after reaction withnitrous acid? Let the letters H represent hypoxanthine and Urepresent uracil.B. Let’s suppose this DNA was reacted with nitrous acid. Thenitrous acid was then removed, and the DNA was replicated fortwo generations. What would be the sequences of the DNAproducts after the DNA had replicated two times? (Note:Hypoxanthinepairs with cytosine.) Your answer should containthe sequences of four double helices.
Match the following terms with their descriptions:Heredity (a) Threadlike molecule of DNA,Chromosome typically circular in prokaryotesPhenotype (b) Permanent alteration in DNAGene (c) Involves the transmission ofAlleles information from an organismMutation to its progenyGenotype (d) Refers to the genetic informa- tion contained in the DNA of an organism (what it actually is) (e) The specific characteristics displayed by the organism (what it appears to be) (f) Linear sequence of DNA that carries coded instructions for…
Please ASAP. Thanku The process by which base pairs combine with each other to form a strand of DNA is called _______. denaturation annealing initial incubation extension mitosis
A bacterium has a genome size of 4.4 Mb. If a researchercarries out shotgun DNA sequencing and sequences a totalof 19 Mb, what is the probability that a base will be leftunsequenced? What percentage of the total genome will beleft unsequenced?
. For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleus
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
n the DNA extraction from fruit laboratory, by what process did cell lysis occur decanting filtering blending mashing measuring . which of the following is an example of quantitive data? the freshman class of the students contained 643 students, 372 males, and 271 females. the absorption peak of cobalt chloride was 510nm bromelain has optimal enzyme activity at a pH of 7 the color of cobalt chloride was pink the mass of the onion was 50 grams
How to write the methodology? I have a practical of HOMOGENIZATION AND FREEZE-DRYING, I need to do a lab report, but I don't know how to write the methodology. Here is the introduction: HomogenizationHomogenization is a process that involves breaking apart cells to release theircytoplasm and its contents. When the purpose is to extract organelles, it is frequentlydone in two steps; first, using a blender to break the tissue up, and then with anultrasonic or mechanical tissue disruptor. The organelles are then generally separatedusing differential centrifugation.Freeze-dryingFreeze-drying also known as lyophilization, and it is a dehydration process typicallyused to preserve perishable material or make the material more convenient fortransport. It works by freezing the material and then reducing the surrounding pressureto allow the frozen water in the material to sublimate directly from the solid phase tothe gas phase.