Answered: BIOLOGY 123, SPRING 2022 LAB STUD Q13.…

BIOLOGY 123, SPRING 2022 LAB STUD Q13. Using examples, explain why the genetic code is considered redundant but not ambiguous.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: 35. The differentiation of the primitive gonads into testes or ovaries depends on the presence or…

A: The Y chromosome have SRY gene which is referred to as the sex determination region. This is present…

Q: Describe the mycobacterial cell wall and give one reason why it is important in the treatment of the…

A: Introduction:Tuberculosis (TB), which is caused by the intracellular bacteria Mycobacterium…

Q: food, butter or margarine

A: Margarine usually tops butter when it comes to heart health. Margarine is made from vegetable oils,…

Q: A correlation between two variables implies that ... one variable may or may not directly affect the…

A: ANSWER;-d) One variable directly affects the other variable. Explain;- Connection is a factual…

Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…

A: The heart is a muscular organ the size of a fist that sits directly behind and somewhat to the left…

Q: Which of the following lipids is NOT found in biological membranes? triacylglycerols…

A: Introduction Lipids are important to our body as they store energy, as well as are required for…

Q: During muscle contraction, which of the following processes takes place? Select one: O a. AMP…

A: Please follow step 2 & 3 for detailed explanation.

Q: Examine closely the dissected 5 different flowers for these characteristics based on: -…

A: Characteristics of the given specimens :-

Q: Larvae and pupae per Bt plant 100 Ö TOKH company -- Mosaic, Cry1Ac plant --- Mosaic, Cry1C plant --…

A: Mosaic treatment of plants and density of moths after treatment.

Q: Predict the effect on the activity of the lac operon of a mutation that disrupts the function of: a)…

A: The Catabolic Activator Protein (CAP) is a protein which acts as a positive regulating factor for…

Q: Two unlinked genes control flower color in snapdragons. You cross a true-breeding yellow flowered…

A: This is a case of recessive epistasis. The rr genotype for R gene is showing epistasis to the W…

Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughters…

A: The cell division consists of two main steps the division of nucleus and the division of cytoplasm.…

Q: Match the letters in the empty boxes to the correct words or structures. A B C D E F G Citric acid…

A: Cellular respiration is a metabolic process in which glucose molecule is used up in the synthesis of…

Q: Which among the following CORRECTLY explains why herbivores have the ability to digest fiber while…

A: Cellulose is a complex carbohydrate. It is a polysaccharide composed of a linear chain of β-1,4…

Q: 5. When used for imaging, the wavelength of the radiation needs to be smaller than the thing being…

A: There are diverse types of bacteria,viruses,protozoa and other microbes exist in our…

Q: PART B Re-watch the video and explain why the following steps are necessary: Why use tweezers to put…

A: Please note as per the site regulations, external links are not watched. Hence, part A cannot be…

Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize yo…

A: Aerobic cellular respiration includes glycolysis, Krebs cycle and ETC.

Q: The following statements are the events that occur during Mitosis. Which of the following is the…

A: Mitosis is the process by which a cell replicates its chromosomes and then segregates them,…

Q: The egfr kinase independent transactivation of the ras pathway does require egfr. Explain this…

A: EGFR is a cell surface receptor that binds to certain growth factors and sends signals to the cell's…

Q: Question 46 The monospot test is a rapid latex kit for the screening of [Select] for the presence of…

A: The monospot test looks for 2 antibodies in the blood.

Q: What kind of membrane protein is found entirely outside the bilayer on either the extracellular or…

A: Introduction Peripheral proteins are membrane proteins which attach only temporarily to the…

Q: Please answer fast Explain how the behavioral and/or physiological response of an organism is…

A: The behavioral and physiological response of an organism is important for its survival. The ability…

Q: 1. It is the creation of an offspring by fusion of haploid gametes, male sperm and female eggs, to…

A: Introduction Reproduction:- It is the process of producing new individuals of the same kind, an…

Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…

Q: A perfect flower is one in which both ________ and ______________ are present.

A: Flower The flower is defined as the reproductive part of the plant which contains male and female…

Q: Question 10 What kind of membrane protein penetrates into the hydrophobic part of the lipid bilayer?…

A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains the lipid…

Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…

A: Ioninzing radiation are those which have higher frequency thereby they have higher energy, so that…

Q: Which will consume highest amount of 1₂ to become saturated? Which has the highest melting point?…

A: Saturated and Unsaturated fats Saturated fats are those that have single binds between their carbon…

Q: Consider the steps involved during the initiation of DNA replication. Explain what will happen if…

A: Introduction DNA replication is a process by which one DNA molecule replicates into two daughter…

Q: Question 6 Phospholipid bilayer is a fluid matrix. O True False

A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…

Q: please answer question b also. b. For the Covid-19 pandemic), give any issues, benefits, or…

A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…

Q: One of the carbon atoms of a glucose molecule is [C14] - labeled. If 14CO2 is released during the…

A: As we know that ,acetyl Co A is formed by beta oxidation of fatty acids or from glycerol utilized…

Q: 90% Arial 12 C | 1 | 21 3 4 5 6. 7 The list gives some structures in the blood and circulatory…

A: Answer : 1. The structure that can destroy bacteria is : White blood cells. The white blood cells…

Q: highlight the statement at the bottom

A: The circulatory system is formed by the heart, the lungs and the blood vessels. The lungs oxygenate…

Q: The cell cycle contains a series of events that control the division of cells. It is controlled by…

A: Cell cycle can be defined as as a sequence of events ,in which duplication of the genome of the cell…

Q: . Give the pathology in : 1 sentence each only g. purpura simplex h. Hereditary hemorrhagic…

A: Pathology can be defined as a branch of science which deals with the study of disease,its cause,…

Q: Peripheral proteins are proteins in the lipid layer facing inside the membrane True False

A: Cell membrane also called as plasma membrane are generally made up of by phospholipid bilayer in…

Q: Describe the step by step method of preparing culture media in microbiology.

A: Culture media are the media or the substrate used to grow microorganisms. There are different types…

Q: Activation of the fatty acid (converting it to fatty acyl-SCoA) requires the expenditure of 2 ATPs.…

A: There are 3 steps of beta oxidation of saturated fatty acids. This phenomena occurrs in the cytosol,…

Q: Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that…

A: Cancer is a condition in which cells proliferate abnormally and infiltrate, erode, and kill healthy…

Q: Milligram of base required to completely hydrolyze & neutralize 1 g of triglyceride/fat sample O…

A: Saponification is described as an hydration reaction, where ester bonds between fatty acids and…

Q: The following image shows Nondisjunction. Which of the following cells will suffer from a genetic…

A: Nondisjunction is a failure of chromosomes to separate during cell division. This results in the…

Q: Sexual reproduction in plants provides genetic variation. What are the benefits of this genetic…

A: Environment is faced by challenges everyday. These challenges directly get upon the species…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Assume that 2.5 ATPs are generated per NADH and 1.5 ATPs per FADH2. How many ATPs are generated from…

A: Beta oxidation is a catabolic pathway in which fatty acids are broken down to acetyl-coA. This…

Q: What is the function of chloroplasts? Which cell types have chloroplasts?

A: Because of specialized organelles, eukaryotic cells are more complicated than prokaryotic cells. All…

Q: Explain how the following conditions will affect the regulation of the operon. (3 pts) Low cAMP…

A: Lac operon is a mechanism seen in the E coli that enables the proper metabolism in its body. The…

Q: How would we explain using examples the non-Mendelian inheritance patterns such as incomplete…

A: Non-Mendelian inheritance It is defined as the inheritance pattern in which the traits are not…

Q: Explain Mendel's Law of Segregation and Independent assortment by connecting them to the process of…

A: Please follow step 2 for detailed explanation.

Q: A ADF F D Match the structure given with the name. Acetyl coenzyme A pyruvate Complex V of the…

A: The given structures in the figure are the structures involved in cellular respiration for the…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

88 ONS COLOR
CHANNES
BIOLOGY 123, SPRING 2022
LAB STUD
Q13. Using examples, explain why the genetic code is considered redundant but not
ambiguous.
within the sixth codon of an mRNA sequence du

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bp
HW # 9 A codon has the base sequence GAA. On which molecule do codons occur? What would be the complementary anticodon, on which molecules do anticodons occur? Which amino acid is specified by this codon? What would be the original sequence of bases in the gene from which the codon was transcribed?
BIOC 385 RNA Processing and Silencing Q11.2: Describe the biochemical mechanism by which RNA splicing occurs precisely at the exon-intron borders considering that a single nucleotide offset by a mistake in splicing will reset the open reading frame register for the encoded protein.
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
Transcribe the DNA sequence that follows. What type of molecule did you make? How many codons are there in this sequence? TACCCAACAATT
The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).