Two strains of corn are 1 m (100 cm) and 3.4 m (340 cm) tall. Assume the difference arises from alleles at four genes, each with two alleles, with one allele of each gene contributing additively to height. The 3.4-m plant's genotype is AABBCCDD and the 1-m plant is aabbccdd. Part 1 How many centimeters of height does each allele that is represented by a capital letter contribute? 1.7 cm 30 cm 42.5 cm 60 cm 120 cm Part 2 What would be the shortest plants produced from the following cross? AaBBccDd× AabbccDd 100 cm 120 cm 130 cm 160 cm 175 cm

Q: Once an action potential reaches a neurotransmitter release site, the release of the…

A: When an action potential reaches the end of an axon terminal, it triggers the opening of…

Q: please can you please annotate the two images attached I would really appreciate it

A: The text provides information on the lesser mealworm, Alphitobius diaperinus, which is a major pest…

Q: Negative selection NK cell Positive selection Regulatory T cell Sphigosine-1-phosphate (S1P)…

A:

Q: What are the nursing responsibilities pre procedure in CT scan?

A: As a nursing professional, the following are some of the key responsibilities that you should…

Q: Part A: State the name of a disaccharide that contains this molecule (structure B).  Part B: A…

A: Introduction :  The six-carbon structure of glucose is represented by the chemical formula C6H12O6.…

Q: Give typed full explanation Given the following sequence of RNA, propose the potential hairpin…

A: A hairpin structure is a secondary structure of nucleic acids, such as RNA or DNA. It forms when a…

Q: what can be problem statement for the topic title: Metabarcoding of yeast communities associated…

A: Yeast: Yeast is a type of single-celled fungi that belongs to the kingdom Fungi. Yeasts are widely…

Q: The order is for Augmentin 200 mg PO every 8 hours. You have on hand Augmentin 125 mg in 5 mL. How…

A: Augmentin is the brand name for a combination of two antibiotics: amoxicillin and clavulanic acid.…

Q: Why is RNAi useful for scientific research (2 reasons)？

A: Introduction  RNA stands for ribonucleic acid. It is a molecule that plays a vital role in various…

Q: Which of the following statements about oxygen transport is TRUE. Increases in temperature and…

A: In terms of primary sequence, myoglobin and hemoglobin are only distantly related. As myoglobin…

Q: 1. A number of different types of RNA exist in prokaryotic and eukaryotic cells. Answer the…

A: RNA is an abbreviation for ribonucleic acid, a molecule that is essential for protein synthesis in…

Q: Which statement is INCORRECT about the cellular respiration process? O Glycolysis occurs in the…

A: Cellular respiration is a metabolic process that occurs in the cells of living organisms and…

Q: Summarize the history of cannabis.

A: Cannabis is an annual, flowering herb. It is commonly known as marijuana. It is used as a…

Q: Give typing answer with explanation and conclusion  Detail the approach of DNA vaccination versus…

A: Introduction: Vaccines are biological preparations that stimulate the immune system to recognize and…

Q: Question 3 Meropenem is a carbapenem antibiotic. Which circle indicates the ß-lactam ring? (research…

A: Providing structural support and defense against osmotic pressure, the cell wall is a crucial…

Q: Pre-lab questions (due at the start of the lab period on a separate sheet of paper 1. What is a…

A: 1.coelom The majority of vertebrates, some invertebrates like annelids, and a few phyla of…

Q: 4. You have a 1.5 g/mL stock solution of protein. To make 200mL of 15 mg/mL solution, add ANSWER…

A: Dilution is the process of reducing the concentration of a solute in a solution by adding more…

Q: 65-year-old m a n with a 5-year history of alcoholic cirrhosis comes to the physician for a…

A: The prothrombin time (PT) is a blood test that measures the time it takes for blood to clot. It is…

Q: Starting with the release of calcium from the SR, explain muscle contraction.

A: Muscle contraction is a fundamental process that allows our bodies to move and perform various…

Q: 12. The following are the gene order on the chromosomes of an individual who is heterozygous for…

A: As the individual is heterozygous for a reciprocal translocation, the synapsis configuration during…

Q: 2. If a plant begins the process of photosynthesis with 50 kCal worth of light energy, how much…

A: Photosynthesis is the process in which the light energy is converted into chemical energy by leaves…

Q: 4. Compare and contrast the mechanism used by competitive and noncompetitive enzyme inhibitors.…

A: Enzyme inhibitors are molecules that can bind to enzymes and decrease or block their activity.…

Q: In rodent development, what would happen if there was no x-fetoprotein to bind the circulating…

A: Introduction  Alpha-fetoprotein (AFP) is a protein that is normally produced during fetal…

Q: dentify the sites of lagging strand synthesis. Select all that are true. 5' D a. C 10 b. D c. B. O…

A: DNA replication is a biological process in which two identical replicas of DNA are produced from one…

Q: The falling phase of the action potential is due to: O Nat influx through voltage-gated Nat…

A: During the rising phase of the action potential, there is a rapid influx of Na+ ions into the cell,…

Q: Which of the following would result in offspring MOST genetically similar to its parent? a whiptail…

A: The correct answer is (d) an aphid arising from asexual reproduction. Asexual reproduction involves…

Q: The shark rectal gland has been a great model for various other structures. Where are the same…

A: The shark rectal gland is a specialised gland found in the rectum of elasmobranchs that regulates…

Q: Demand that the beneficiaries of basic research (e.g., tech, industry, pharma) conduct more basic…

A: Basic research is key to innovation, but has a funding problem. In terms of the quality of the…

Q: What other online tools are available for nucleic acid sequence analysis? What can they be used for?…

A: There are many online tools available for nucleic acid sequence analysis, and some of them are…

Q: After Hippocrates, Galen is considered the greatest physician in ancient times who helped refine and…

A: The topic is about the history and influence of Galen, a Greek physician, anatomist, and philosopher…

Q: As "sensitivity" declines with age (in hearing or sight), which one below is not the best way to…

A: The ability of the ear to detect and process sounds at various volumes or frequencies is referred to…

Q: In the electron transport chain, where do the electrons come from?

A: Electron Transport Chain: The electron transport chain (ETC) is a series of protein complexes…

Q: Intracellular receptors usually bind + O Water-soluble signals O Large molecules that act as signals…

A: Introduction :- Receptors are specialized proteins that are located on the surface or within cells,…

Q: Question 11 (Population/Quantitative Genetics) A (dominant) and a (recessive) are alleles whose…

A: Hardy Weinberg equation describes the distribution of alleles in a population. This equation applies…

Q: new dNTPs can be added at the start of replication, this is done by an enzyme called      RNA…

A: DNA is made up of deoxyribonucleotides. DNA exist in two strands and both the strands are linked by…

Q: Are articular and hyaline cartilage the same thing?

A: A strong, flexible connective tissue which protects our joints and bones is known as Cartilage. It…

Q: Please help with this homework assignment…

A: Genome-wide association studies (GWAS) are a type of genetic analysis that looks for associations…

Q: Can you please annotate the two images attached. • Highlight information • Make notes in margins…

A: The text describes a study on the lesser mealworm, Alphitobius diaperinus, a pest in commercial…

Q: What are the major acute and chronic physiological effects of cannabis on the body?

A: Cannabis, also known as marijuana, has physiological effects on the body that are both acute and…

Q: A. In the following table, indicate which of the sequences would be a possible restriction…

A: Most restriction enzymes only break down one phosphodiester bond on every strand and may detect…

Q: RNA lacks the stability of DNA. Why? a) It has an unmethylated uracil. b) It is originally produced…

A: DNA is a genetic molecule that is the molecule of inheritance which transmits certain…

Q: What disease does this organism cause

A: The above image if of Entamoeba genus.It is a single cell organism with a distinct nucleus. We have…

Q: In the table, you have to  identify the character for Genus Identification of the  Cyanobacterium E…

A: The details of the oscillatoria are already given in detail in the earlier answer by the expert.…

Q: What is needed for a T cell to progress from pro- to pre-T cell

A: T cells develop through a complicated process of differentiation and maturation from hematopoietic…

Q: How does Ibuprofen work to reduce fever and pain and inflammation? It is an enzyme that catalyzes…

A: Ibuprofen is a non-steroidal anti-inflammatory drug (NSAID) that is commonly used to relieve pain,…

Q: Place this events in the correct order that they occur during homologous recombination: A.…

A: A kind of genetic recombination called homologous recombination involves the exchange of nucleotide…

Q: Which of the following is a circulatory adjustment to sustained moderate exercise? a. Constriction…

A: Circulatory adjustment refers to the physiological changes that occur in the body's circulatory…

Q: laboratory to test the effectiveness of a vector for correcting the DF508 –CFTR mutation.  The…

A: Introduction: CFTR stands for Cystic Fibrosis Transmembrane Conductance Regulator. It is a protein…

Q: Short Essay: Answer the prompt in 4 sentances or less. Describe the staining technique used to…

A: Staining is a protocol used to visualize cells/ tissues under a microscope. Staining colors and…

Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…

A: Genes are hereditary structures on genetic material. These control some specific particular traits.…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.