Question
Asked Oct 27, 2019
2 views

Use the table to answer:

 

A portion of an mRNA attached to a ribosome reads:

5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′

If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid?

What is the last amino acid in this polypeptide?

Which amino acid will be the most frequent in the polypeptide?

second letter
UAU Tyr
UUU
UGU
UGC
UCU
Phe
UAC
Ser
UUC
UUA
UCC
UCA
Leu
UGG Trp G
uUG
UCG
CAU
CUU
CCU
ССС
CGU
CAC His
CGC
Arg
CGA
CUC
C
CUA
CAA Gin
Pro
Leu
ССА
CCG
CAG
CGG
CUG
AUU
ACU
AAU
AGU
Ser
AAC Asn
AUC lle
A
ACC
Thr
AGC
AGA
AUA
ACA
АA
Lys
Arg
AGG
АCG
AAG
GUU
GUC
G
Val
GUA
GUG
GAU
Asp
GAC
GCU
GGU
GGC
GCC
Gly
GGA
Ala
GAA G
GAG
GCA
GCG
GGG
first letter
third letter
help_outline

Image Transcriptionclose

second letter UAU Tyr UUU UGU UGC UCU Phe UAC Ser UUC UUA UCC UCA Leu UGG Trp G uUG UCG CAU CUU CCU ССС CGU CAC His CGC Arg CGA CUC C CUA CAA Gin Pro Leu ССА CCG CAG CGG CUG AUU ACU AAU AGU Ser AAC Asn AUC lle A ACC Thr AGC AGA AUA ACA АA Lys Arg AGG АCG AAG GUU GUC G Val GUA GUG GAU Asp GAC GCU GGU GGC GCC Gly GGA Ala GAA G GAG GCA GCG GGG first letter third letter

fullscreen
check_circle

Expert Answer

Step 1

Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two subunits 40S and 60 S in eukaryotes, that bring together mRNA and tRNA to catalyze protein ...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.
Tagged in

Science

Biology

Related Biology Q&A

Find answers to questions asked by student like you
Show more Q&A
add
question_answer

Q: Which of the following molecules would you expect to diffuse through the lipid bilayer of a plasma m...

A: Large molecules like Glucose, starch, and amino acid, requires transmembrane carrier proteins to dif...

question_answer

Q: 6. Consider your btoehr and your son. a. If you are female, will your brother and your son have esse...

A: The sex chromosomes are involved in the sex determination. Females have XX chromosomes and the males...

question_answer

Q: A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity...

A: In bacteria, two transcription termination mechanisms take place. Intrinsic termination, which is th...

question_answer

Q: If a man has an X-linked recessive disease, can his sons inherit that disease from him? Why or why n...

A: The X-linked recessive disease is caused by a mutation in X chromosomes. X and Y are two sex chromos...

question_answer

Q: For a ganglion cell that has a red ON center and Green OFF surround, explain how frequent these gang...

A: The ganglion cells are the only ones that send out neural signals in the form of action potentials. ...

question_answer

Q: How do I create a forked line graph for crossing two genotypes? Such as AaBb•aaBB

A: The forked-line method can be used to  solve dihybrid and multihybrid crosses. A problem is converte...

question_answer

Q: Which of the following organelles produces and modifies polysaccharides that will be secreted by a p...

A: Prokaryotes are unicellular organisms that lack membrane bound organelles. They are of two types; ar...

question_answer

Q: Discuss the functions of muscle proteins (8 or more) and give an example for each.

A: Muscles belong to the category of muscular tissues that arise from mesodermal layer during the embry...

question_answer

Q: How do we get trans fat?

A: Click to see the answer