Derive the amino acid sequence that is coded for by each of the following mRNA sequence.  5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCC

Q: 1.Classify each protein as fibrous or globular. A. hemoglobin B. keratin C. myoglobin

A: Proteins are classified into two categories, on basis of shape and solubility.   1. FIBROUS PROTEINS...

Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,...

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,...

A: The amino acid sequence of a peptide is called the primary structure of a protein and determines the...

Q: Which of the following statements regarding size exclusion chromatography is false?     During siz...

A:            Hi! Thank you for the question, as per the honor code, we are allowed to answer the first...

Q: Enumerate the similarities and the differences of Chlorophyll A and B. Similarities Differences

A: Introduction: Chlorophyll is a natural fat-soluble molecule found in plants that allow plants to con...

Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...

A: Centrifuge is a device used for separating molecules having different densities. The process is call...

Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...

A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...

Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- CH,O...

A: Enzymes are biocatalysts that speed up biochemical reactions. These are mainly three dimensional glo...

Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino ac...

A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in th...

Q: Which of the following statements are TRUE about eukaryotes? (i) They are cells with a nucleus. (ii)...

A: Cell is the structural and functional unit of life. It can be classified into prokaryotic and eukary...

Q: Given the active site and reaction mechanism below, what is the mechanism of rreversible inhibition ...

A: The mechanism followed by the given example is of Transition state analog Chemical compounds with a ...

Q: 4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served b...

A: The peptide sequence using 3 letter amino acid code is given below. N-Glu-Thr-Ala-Thr-Lys-Ala-Glu-Le...

Q: ummarize what happens during protein processing

A: To be functional, all freshly produced polypeptides must be folded into their three-dimensional stru...

Q: During the formation of the peptide bond which of the following takes place? a. Hydrogen atom is lo...

A: Between the α-nitrogen atom of one amino acid and the carbonyl carbon of another, a peptide bond, al...

Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino...

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...

Q: king of acid

A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as prot...

Q: Given the active site diagram below, identify the numbered region corresponding to an acidic catalyt...

A: An acid is a molecule that can accept a proton from the solution and a base is a molecule that can d...

Q: Given the active site and reaction mechanism below, what is the mechanism of irreversible inhibition...

A: The given example is uncompetitive inhibition. Uncompetitive inhibition, also known as anti-competit...

Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange ...

A: Chromatographic techniques are used to separate specific molecules from a mixture of different molec...

Q: Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. I...

A: Nucleic acids are of two types : DNA and RNA. DNA refers to Deoxyribonucleic acid. It is genetic mat...

Q: Test Done and Result Carbohydrate Identity Molisch test Seliwanoff's test Benedict's test Barfoed's ...

A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature t...

Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...

A: There are twenty naturally occurring amino acids that form proteins in biological systems. 

Q: A. Heteroglycans are polysaccharides with only one type of monosaccharide unit. Heparin is a heterog...

A: Polysaccharides that are comprised of same type of monosacharide units, then it is termed as homopol...

Q: or each solution, calculate the rate of weight change over this 30-minute period.  *****Please Show...

A: Given the weight of potatato slices immersed in 0M, 0.4M 0.6M, 0.8M and 1 M sucrose solution over 30...

Q: I. True or False   a. The beta-pleated sheets are formed by H-bonds among adjacent regions of the pe...

A: A. FALSE - The beta-pleated sheets are formed by H-bonds between neighbouring strands.  

Q: What is experiment of Thermodynamics of Small Oligomeric Duplex DNA Denaturation.

A: Double-stranded DNA is the most common kind of DNA molecule found in nature. The strands can be unwo...

Q: 2. You have made a mutation in myoglobin that increased the Pso for O2 by a factor of 2. Sketch out ...

A: Myoglobin is a non-allosteric enzyme found in muscle cells. The main function of myoglobin is to sto...

Q: 3. When you think about the primary structure of the mannose-6-P receptor, assuming that it is an in...

A: The internal amino acid sequences in the membrane protein carries the information that determines th...

Q: For the ion concentrations in Table 12.1, calculate the equilibriumpotentials for each ion species i...

A: ions can move in either direction through a channel (i.e., either into or out of the cell) the d...

Q: Identifies the roles of ventilation and PCO₂ in acid/base balance . Answer ASAP .

A: Acid is present in body in stomach.Acid and base balence in body is important for human health.Acid ...

Q: Which of the following contain a correct first statement and an incorrect second statement?     Be...

A: G proteins consist of the alpha, beta and gamma receptors for activating the cell signaling mechanis...

Q: How does a protein form?

A: Proteins are the heteropolymers of twenty standard amino acids attached together via peptide bonds. ...

Q: Uncatalyzed -Enzyme A - Enzyme B C12H22011 + H,0 2C,H,,0. For the reaction shown, it can reasonably ...

A: Enzymes are biocatalysts which increase the rate of biochemical reactions by decreasing the activati...

Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by

A: What is glycoproteins: Glycoproteins are molecules that comprise protein and carbohydrate chains tha...

Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...

Q: 32. Which one of the following is NOT a typical characteristic of the active site of an enzyme? A) T...

A: Substrate molecules bind to the enzyme, which then undergoes a chemical reaction. The active site is...

Q: Please provide a chromatography technique to isolate the protein A from the mixture containing prote...

A: Protein A :- positively charged Protein B :- negatively charged For separation of charged molecules ...

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...

A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...

Q: The restriction digests of the cloned Drosophila gene can provide direct visible evidence of a mutat...

A: We can use the technique of Southern blotting to detect and isolate the DNA fragment with the Gene O...

Q: At eukaryotic origins of replication, helicase cannot be activated until the polymerase is also posi...

A: Deoxyribonucleic acid, or DNA, is a type of biomolecule known as nucleic acid. The important compone...

Q: Explanations are not needed. Direct answers are enough.   II. True or False   a. An effort is usuall...

A: The protein molecules after their folding have exposed patches of charged amino acids on their surfa...

Q: What are the biomolecules that are used to biosynthesize a purine ring in the de novo pathway – prov...

A: Purine de novo synthesis is a time-consuming process. It happens actively in the liver cytosol, wher...

Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K without affectin...

A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...

Q: Typically, opiates have the ability to a. cause intense hallucinations. b. suppress the sensation of...

A: The correct answer is b. suppress the sensation of pain A drug that is used to relieve pain or induc...

Q: unfold the protein

A: here they are talking about protein unfolding. The tension applied by the cantilever during protein ...

Q: Name the following nucleotide: HN P-0-P-0-CH2 OH

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and Ribonucle...

Q: Answer choices are provided below for drop-down questions. 1. The overall charge of this protein at...

A: Since you have asked multiple questions and haven't specified which has to be answered. Therefore, a...

Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be phos...

A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle A...

Q: 2. Draw the structure of the tripeptide Gly-Ala-Tyr H H. N-C-C H N-C-C + N-C-C + H он он CH3 H. 0-H ...

A:             Proteins have four levels of structural organization including Primary, secondary, terti...

Q: Why is stereochemistry of biomolecules important in biological processes?

A: Stereochemistry is the Study of three dimensional structure of molecules and their effect on the fun...