Using the pk values, calculate the pl for each of the following: Isoelectric Amino acid/peptide point а.) Y b.) I с.) Н

Q: How would chymotrypsin's catalytic triad be affected by extremely low and extremely high pH values…

A: Enzymes are catalysts that increase the rate of the chemical reaction without undergoing any change…

Q: Draw simple peptides from individual amino acids, and label the N- and C-terminal amino acids

A: Amino acids are the simplest building blocks found in proteins. They are linked together by amide or…

Q: Which nuclear isotope used in protein NMR spectroscopy is the most sensitive to detect? Briefly…

A: NMR Spectroscopy is used to study the structure and composition of biomolecules like proteins. Here…

Q: technique is used to identify the binding partner for Izumo?

A: Sexual reproduction helps in the increase in progeny of almost all eukaryotic organisms. Sperm meets…

Q: Write the Structure Activity Relationship ( SAR)  of Captopril ?

A: Captopril is an antihypertensive drug and is used for the treatment of renovascular hypertension. It…

Q: For a protein that binds multiple ligands with negative cooperativity, which of the following is…

A: The ligand binds to its target molecule

Q: C

A: This question can only be answered hypothetically by taking the standard Rf values of some polar…

Q: Define the term motilin?

A: The digestive system is made up of the gastrointestinal tract and the accessory organs of digestion…

Q: Which of the following is not one of the basic features used in protein separation techniques? a.…

A: Protein separation is a series of cycles proposed to disengage one or a couple of proteins from a…

Q: What is the diference between soluble and insoluble iber?

A: Fiber can be defined as the roughage, it is the part of plant-based foods that includes the grains,…

Q: For each of the following denaturing agents, explain the changes that you observed when each of them…

A: Egg white contains a high level of protein. Denaturation is the process in which protein loses its…

Q: An amino acid was titrated with NaOH and the following curve was obtained. Which of the following…

A: The given titration curve is of the amino acid glycine.  Glycine has a pk1 of 2.34, pk2 of 9.60 and…

Q: What is protein denaturation? Give five agents that can denature proteins  Is it possible for a…

A: Proteins are one of the macromolecules that are present in living organisms. Proteins are made of…

Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…

A: Reverse phase chromatography is a technique for separation of non-polar molecules from polar…

Q: Why do the pK values of ionizable groups differ between free amino acids and amino acid residues in…

A: The acid dissociation constant (Ka) is the quantitative measure of the strength of an acid or amino…

Q: For the binding of a ligand to a protein, what is the relationship between the Ka (association…

A: The ligand in protein-ligand binding is typically a molecule that generates a message by connecting…

Q: At what pH will you be able to separate the amino acids val, his and arg?

A: Amino acids are biomolecules with a central carbon bonded to 4 different groups. 3 of these 4 groups…

Q: If an antibody binds its antigen with affinity of 150 nanomolar, what is the standard binding energy…

A: The binding and dissociation interactions between an antibody (Ab) and its antigen (An) is shown…

Q: What is the concepts of the native conformation of proteins? Why and how do proteins refold and…

A: Proteins are polypeptide structures consisting of one or more long-chain amino acid residues. They…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Describe a general scheme for protein purification of a protein like hemoglobin

A: Protein Purification: The protein Purification is done is to retain more number of function proteins…

Q: Identify and match the lettered regions in the titration curve of a basic amino acid. pic 5.jpg…

A: Histidine is an amino acid that has an imidazole ring as the functional group (R group). Thus, the…

Q: What is the one letter code for this amino acid? What is the pH range that this amino acid will…

A: Amino acids are organic compounds that form the building blocks of proteins that are important for…

Q: a. Why proteins are extracted to a buffered solution? Briefly describe the components of a…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Which of the following would be considered an incomplete protein?

A: Proteins are macronutrients needed for tissue growth and repair, digestion, immunity, and…

Q: Student A says that he can insert any value of optical density in the equation of standard curve to…

A: Protein contains aromatic residues which absorb the maximum light of 280 nm wavelength. The amount…

Q: Use three diagrams to illustrate the separation of three different proteins by the method of…

A: Ion-exchange chromatography is an analytical technique that plays a vital role in separation of…

Q: If an amino acid weighs 100 Da, and the protein contains 70 amino acids, what is the weight of the…

A: Amino acids are the building blocks of proteins. Multiple amino acid units are joined together to…

Q: Draw the peptide PVLED and determine the following: Isoelectric point, pI The net charge at pH =…

A: The given peptide is composed of proline, valine, leucine, glutamic acid, and aspartic acid. The…

Q: What is the Beer-Lambert’s Law? Why is it relevant to the quantitative analysis of proteins?

A: The Beer-Lambert Law is given by It is a relationship between the absorption of light energy by a…

Q: To select the correct statement about ion exchange chromatography below, consider the pl and the…

A: Amino acids are the constituent monomers of the polymer proteins. Amino acids have a characteristic…

Q: What is meant by denaturation of proteins? Give examples of protein denaturating agent?

A: Proteins are composed of amino acids attached together in a linear chain of via peptide bonds.…

Q: What is the TOTAL NET CHARGE of a free arginine amino acid at pH = 12.5?

A: Arginine is a basic amino acid in which three ionizable groups present. Arginine amino acid consists…

Q: Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi…

A: Ramchandran plot is a two dimensional plot used to visualize energetically allowed regions for…

Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…

A: The normal phase chromatography has a polar stationary phase and a non-polar mobile phase. The…

Q: please calculate the unknown concentration of the protein A wih an absorbance value of A188 given…

A: Absorbance = -log (I / Io) where I is intensity of transmitted light and Io intensity if incident…

Q: How can you separate and identify Molecular weight of target protein from a protein sample?

A: Proteins are composed of amino acids. Different amino acids have different molecular weight. So,…

Q: In what type of intra and intermolecular interactions does a valine within a protein backbone…

A: Hemoglobin A is composed of two α and two β-globin chains along with the heme molecule which…

Q: n case of the same amino acid as in the picture, in which ionization state would this amino acid be…

A: Amino acid given in picture is tyrosine. It is aromatic amino acid having uncharged polar…

Q: What is the Rf value of each amino acid observed?

A: Rf ( retardation factor):- It is defined as the ratio of distance traveled by the centre of a spot (…

Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…

A: In the given data pKa  of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…

Q: Is an SDS-PAGE gel, what characteristic is used to separate the proteins?  Which proteins move…

A:

Q: A particular amino acid contains a -CH2NH3+ group.  Is this amino acid more likely to be found on…

A: In a folded globular protein charged and polar amino acids on the surface of the protein are…

Q: What is G-banding?

A: Chromosomes are thread-like structures situated inside the nucleus of plant and animal cells. Each…

Q: What contributes to the asymmetric protein distributions ?

A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…

Q: What is An enzyme that denatures PROTEIN?

A: The change of shape of a protein by external action, which may or may not change the amino acid…

Q: What intermolecular forces hold protein subunits in a quaternary structure?

A: The protein's quaternary structure is the association of several protein chains or substituents into…

Q: A two-dimensional gel electrophoresis of a protein preparation revealed the presence of five…

A: Size exclusion chromatography is another name for gel filtration chromatography. Gel filtration…