Q: Streptococcus pneumoniae cells of genotype str s mtl - are transformed by donor DNA of genotype strr...
A: It is the genetic alteration of a cell resulting from the uptake and expression of foreign genetic m...
Q: Phytochemical test Physical description of extract: Color: Reddish brown Odor: Aromatic Transparency...
A: Phytochemical tests are the confirmatory tests for the presence of different components like alkaloi...
Q: 1. Cite five diseases that could be diagnosed with the determination of enzyme concentration. 2. Giv...
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...
Q: Which among the following statements is correct? Group of answer choices Both statements are incor...
A: Chromatography is a technique used for separation of molecules based on the principle of distributio...
Q: Please help me in detail. for molecular Mechanism of ATP versus GTP selectivity of adenylate kinase,...
A: Enzyme substrate selectivity is required for precise control of metabolic pathways. In cases where c...
Q: Between glucose and fructose, which monosaccharide is metabolized faster? Why?
A: Both glucose and fructose are monosaccharides. Both undergo oxidation and produce two molecules of p...
Q: An enzyme following Michaelis-Menten kinetics was found to have highest activity at 37° C and pH 7. ...
A: Turnover frequency is the efficiency of an enzyme which is calculated from its turnover number . Tur...
Q: Rhodium and other transition metals are generally used in heterogeneous/homogeneouslenzyme catalysis...
A: Enzymes are the biocatalyst which promotes the biochemical reactions in any living organism. The enz...
Q: Why is it important to study the strength of acids and bases?
A: Any hydrogen-containing substance capable of transferring a proton (hydrogen ion) to another chemica...
Q: The genetic data below is the DNA sequence of part of a theoretical fungal genome. a.) Which strand ...
A: DNA is a double stranded molecular structure with anti parallel stands of polarity 5' --->3' and ...
Q: The charge of particular functional groups is dependent on the environment they are in. Predict the ...
A: The pKa of the side chains of amino acid residues in proteins determines the net charge on the amin...
Q: When are free radicals formed? A. Only in disease states, because that is what initiated the dise...
A: Free radicals can be defined as a type of molecule that has 1 or >1 unpaired electron & they ...
Q: Cellular Respiration and Fermentation Word Search please help me find words related to Cellular resp...
A: I could find some words but not all.
Q: Give the complete name of the peptide below.
A: A peptide is a molecule that contains two or more amino acids linked together via peptide bonds. A p...
Q: ATP Synthase is known to catalyze the synthesis of ATP with a ΔG°’ close to zero, and a Keq' close t...
A: The F1/F0 ATP synthase catalyzes the conversion of ADP to ATP coupled with the movement of protons a...
Q: Analyzing: Analyze the following pair of monosaccharides and determine which of the following is an ...
A: Since there are multiple questions and they are not interlinked, as per our company guidelines only ...
Q: True or false: Disulfide bonds between side chains stabalize the structure of proteins by increasing...
A: Disulphide bonds are sulphur- sulphur bonds that form between side chains of two cysteine residues i...
Q: Explain why oils become rancid. Provide short and concise answer with relevant examples.
A: Fats and oils are made up of triglycerides, which are esters made up of three fatty acid units bound...
Q: Which of the following is the odd one out? NADP FMN NAD
A: Introduction: A coenzyme is a cofactor that consists of small organic molecules, many of which are d...
Q: Which of the following is not a carbohydate? O C7H1407 O C5H1005 O C5(HO)5 O C6(H2O)6
A: Carbohydrates are macronutrients and are one of the three main sources of energy for our body. They ...
Q: 12.49.Explain why it is essential that fl uids used in intravenous injections have approximately the...
A: Intravenous fluids (IVFs) are one of the most used medical procedures for resembling physiologic bod...
Q: List 2 proteins that facilitate protein folding and briefly describe the role each play in the lifet...
A:
Q: Calculate the amount of ATP generated from the total oxidation of an unactivated polyunsaturated C21...
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic p...
Q: What are the nucleotides of the mRNA from gene Z? (see the attached picture)
A: Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the templat...
Q: With the aid of the simple generic diagram, identify and explain how the type of chemical bonding st...
A: An alpha helix is a periodic secondary structure in proteins. This secondary structure is stabilized...
Q: INTRUCTIONS: - Do not copy here in BARTLEBY or GOOGLE - PLEASE ANSWER PROPERLY Failed to follow inst...
A: The most prevalent lipids in nature are fats and oils. They give life energy, protect bodily organs,...
Q: What is the relative activity of the two structures shown below on the opioid receptor? HO HO. O A i...
A: Opioids are group of morphine- like chemicals medically used as anesthesia and as pain relief. The s...
Q: INTRUCTIONS: - Do not copy here in BARTLEBY or GOOGLE - PLEASE ANSWER PROPERLY Failed to follow inst...
A: Soap is nothing but a salt as a result of saponification. Now for saponification to happen there has...
Q: How can a person make ethanol?
A: Introduction: It is commonly called alcohol, ethyl alcohol, and drinking alcohol. It is a neurotoxin...
Q: Which of the following is true concerning cellulose? Question 24 options: Can only be broken d...
A: Carbohydrates are composed of carbon, hydrogen, and oxygen in the ratio of 1:2:1. The carbohydrates ...
Q: NEED ANSWER ASAP PLEASE
A: Metabolic pathways are the combination of catabolic and anabolic reactions. Metabolic pathways synth...
Q: 5. At pH 7, the net charge of tyrosine is? А. -2 В. -1 С. 0 D. +1 E. +2
A: PH is defined as the negative logarithm of H+ ion concentration. The amount of H+ ions in a solution...
Q: Find a protein of your choice, choose a part of it (containing at least 30 amino acid residues), fin...
A: A 60 amino acid long portion of the protein (an enzyme ) trypsin from a species of camel (Camelus dr...
Q: 5. You are imprisoned in a biochemistry lab by an ogre (one of Shrek's kids) who wants you to purify...
A: Proteins are polymers of amino acids linked by amide or peptide bonds. pI of the proteins are the pH...
Q: If the disaccharide maltose is formed from two glucosemonosaccharides, which are hexose sugars, how ...
A: Carbohydrates are the most important macronutrients for most organisms. Carbon, hydrogen, and oxygen...
Q: Fill in the blanks. The citric acid cycle converts two-carbon units into In the process the carbons ...
A: Citric acid cycle: The citric acid cycle is also known as the tricarboxylic acid cycle is an amphibo...
Q: In the Watson-Crick model of DNA structure: Question 5 options: T can form three hydrogen bond...
A: DNA means deoxyribonucleotides. DNA is a polymer of nucleotides attached together via phosphodiester...
Q: Baby A was a term female infant born via uncomplicated vaginal delivery. • Maternal serologies were ...
A: Pregnancy: Pregnancy is a 36-40 weeks long incubation period for the growth and development of fetus...
Q: What factors affect denaturation and refolding of proteins
A: Denaturation(unfolding) is the process in which protein loss the three dimensional structure by brea...
Q: Discuss how carbohydrates can be stored as fat. Please answer precisely, clearly, and directly.
A: Carbohydrates are the primary source of energy for the body, and glucose is the simplest form of car...
Q: G1: CASE ANALYSIS A 28 year old woman is seen with an easy fatigue for a couple of months. She is c...
A: Symptoms mentioned here for 28 years old lady with two babies in 2 years Symptom 1: Taste of eating ...
Q: intermittent fasting
A: The question is all about the intermittent fasting we also can say it is a fasting and eating plan t...
Q: Give an alternative form of CpG methylation, given clear handwritten explaination!
A: DNA methylation is known to be one of the major epigenetic marks. The cytosines that are methylated ...
Q: 1. Based on your knowledge about gums and mucilages, how will you differentiate resins from them? (O...
A: Q. 1. Mucilages are generally normal products of metabolism (physiological products), formed within ...
Q: Explain energy has bias in Biochemistry
A: Bioenergetics is the quantitative study of the energy transductions that occur in living cells and ...
Q: An E. coli replication fork is shown in Figure 2.2. III 3' IV 5 II Figure 2.2 (i) Identify the laggi...
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucle...
Q: What happens to glycine if it is titrated by a strong acid like NaOH? Calculate the Isoelectric poin...
A: When an amino acid is titrated with increasing volume of NaOH then the ionizable groups on the amino...
Q: Which of the following is an indication that a glycerol molecule reacted with potassium hydrogen sul...
A: When glycerol molecules reacts with potassium hyderogen sulphate, it causes the dehydration of glyce...
Q: 50 y = 47.5837x + 14.4554 R? = 0.9989 [AMP] = 5 mM y = 37.2228x + 13.0690 R? = 0.9991 [AMP] = 5 mM [...
A: The given plot is the line-weaver Burk plot of the enzyme kinetic data. Line-weaver Burk plot gives ...
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: gyrase si...
A: DNA is a genetic material that is a double stranded structure polymer of nucleotides. DNA replicatio...
Five amino acids were subjected to normal phase chromatography, and the following Rf values were computed:
A - 0.59
B - 0.12
C - 0.71
D - 0.33
E - 0.20
Which is the most polar amino acid?
Step by step
Solved in 2 steps
- Five amino acids were subjected to reverse phase chromatography, and the following Rf values were computed: A - 0.23 B - 0.08 C - 0.54 D - 0.74 E - 0.96 Which is the most polar amino acid? Group of answer choices E D B C AFive amino acids were subjected to reverse phase chromatography, and the following Rf values were computed: A - 0.23 B - 0.08 C - 0.54 D - 0.74 E - 0.96 Which is the most polar amino acid?What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
- Some characteristics of three proteins are listed in the table below: Protein Molecular Weight (Da) Isoelectric point (pI) Does the Protein Contain a heme moiety? 1 75,000 5.0 No 2 12,500 4.8 No 3 73,000 9.8 Yes a. What type of chromatography separates proteins based on their size? b. What type of chromatography separates proteins based on their charge? c. Could gel filtration chromatography be used to separate a mixture containing Protein 2 and 3? Clearly explain why or why not. If gel filtration chromatography can be used to separate Protein 2 from Protein 3, which protein would elute first (clearly explain why)? After collecting the fractions from the column, the absorbance of each fraction will be measured using a spectrophotometer. Can both proteins (Protein 2 and Protein 3) be monitored at 280nm and 400nm (clearly explain)? d. Which 2 proteins listed in the table above could be separated by ion exchange chromatography but NOT by…What is the Beer-Lambert’s Law? Why is it relevant to the quantitative analysis of proteins?How many grams of glucose (C6H2O6 molecular mass =180daltons) would be present in one liter of a 1M (molar) solution of glucose?
- 1.2. Using DEAE-cellulose as ion exchange resin, indicate the starting and ending pH for the narrowest experimental pH range used to separate an amino acid mixture consisting of Cys, His and Leu Starting pH: _____ Ending pH: _____In the 1970s, a process was developed thatconverts the glucose in corn syrup to its sweeter-tasting isomer, fructose.High-fructose corn syrup, a common ingredient in soft drinks and processedfood, is a mixture of glucose and fructose. What type of isomers are glucoseand fructose?Four known amino acids (AA) produce a chromatograph with Rf values as follows: AA1 =0.25, AA2 =0.66, AA3=0.50,AA4=0.80. A mixture of three amino acids yields spots that are 2 cm,5.2cm, and 6.4 cm from the organ. The solvent front is 8.0 cm from the origin. Which three of the four amino acids are contained in the mixture?
- Tomato juice has a OH- concentration equal to 1 X 10 -10, what is the pH of this solution?Can we determine the type of monosaccharide with the Molisch experiment?WHAT ARE THE ADVANTAGES AND DISADVANTAGES OF CARBOHYDRATES IN BIOCHEMISTRY? GIVE AT LEAST 3 FOR EACH AND EXPLAIN. WHAT IS THE PRINCIPLE AND APPLICATION OF BENEDICT'S TEST IN THE TEST FOR REDUCING SUGAR?