Continuing from the question above. You are able to correctly modify the blood stem cells and return them to the patient, and her symptoms improve. One week after the treatment is deemed successful, the patient decides to embark on in vitro fertilization. You sequence the genome of one of the patient's egg cells (gametes). Would you expect the egg cell to have the mutant copy or a corrected, normal copy of the B-globin gene? O The wild-type copy, because you have altered original patient's germline. O The mutant copy, because you have altered the original patient's germline. O The wild-type copy, because you have NOT altered original patient's germline. O The mutant copy, because you have NOT altered original patient's germline

Continuing from the question above. You are able to correctly modify the blood stem cells and return them to the patient, and her symptoms improve. One week after the treatment is deemed successful, the patient decides to embark on in vitro fertilization. You sequence the genome of one of the patient's egg cells (gametes). Would you expect the egg cell to have the mutant copy or a corrected, normal copy of the B-globin gene? O The wild-type copy, because you have altered original patient's germline. O The mutant copy, because you have altered the original patient's germline. O The wild-type copy, because you have NOT altered original patient's germline. O The mutant copy, because you have NOT altered original patient's germline

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Now that you understand how the CRISPR-Cas9 system works, think back to the experiments discussed in the introduction to this chapter, in which researchers used CRISPR-Cas9 genome editing to treat mice with Duchenne muscular dystrophy. Why did the researchers choose to cut out the entire exon 23 in the mice with the disorder? Why not replace the specific mutation using a donor piece of DNA and homologous recombination? Propose some possible explanations.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explain
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?. If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located?
You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?
You are studying the tryptophan synthetase gene that Yanofsky also examined to determine the relationship between the nucleotide sequence and the amino acid sequence of the gene. Yanofsky found a large number of mutations that affected the tryptophan synthetase gene. A) If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located? B) Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also recovered a nonsense mutation that changed amino acid number 15 into a stop codon. This codon normally encodes Lysine. Does the recovery of this mutation support the hypothesis that this Lysine residue is critical in the function of the tryptophan synthetase protein?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides? What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes? What type of mutation is present in the mutant hemoglobin gene?
You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides?
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?