What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA

What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 11SQ: Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from...

See similar textbooks

Similar questions

Which statement about Okazaki fragments is true? Select one: a. DNA polymerase doesn’t need a primer to build these fragments b. They act as a primer that initiates DNA replication. c. They correct errors made during earlier phases of DNA replication. d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork. e. They prevent the ends of chromosomes from shortening with every replication.
What is the basis for the difference in how the leading andlagging strands of DNA molecules are synthesized?(A) The origins of replication occur only at the 5′ end.(B) Helicases and single-strand binding proteins work at the5′ end.(C) DNA polymerase can join new nucleotides only to the3′ end of a pre-existing strand, and the strands areantiparallel.(D) DNA ligase works only in the 3′ S 5′ direction
What is the basis for the difference in how the leading and lagging strands of DNA molecules are synthesized? a. The origins of replication occur only at 5'end b. Helicases and single-strand binding proteins work at the 5'end c. DNA polymerase can join new nucleotides only to the 3' end of a pre-existing strand d. DNA ligase works only in the 3'-5' direction
DNA strands are anti-parallel and DNA polymerase can only synthesize DNA in a 5' to 3' direction. How does the enzyme synthesize both strands at the same time? A. The leading strand is sythesised in Okazaki fragments B. The lagging strand is synthesised in short Okazaki fragments. C. Only one strand is replicated. D. There are more than one DNA polymerase involved.
You are studying a colony of cells and determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. A) What will the effect of the mutation in DNA polymerase I be on DNA replication? In your answer make sure to describe what would be observed in the leading and lagging strand and explain your reasoning. B) Will this mutation in DNA polymerase I have an impact on another step in DNA replication? In your answer make sure to indicate whether DNA replication will be impacted or not. If it is not, explain why. If it is impacted, then describe the step that is impacted and name the molecule or enzyme involved.
Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases? A. The active site contains 2 divalent metal ions B. A single stranded DNA template is required C. The enzyme can only attach a new deoxynucleotide to the 5’ end of a growing chain D. The 3’OH on the deoyxyribose ring attacks a phosphate of a dNTP to produce a new phosophodiester bond E. None of the above (all are true statements)
Okazaki fragments are ________. A. short RNA primers needed for initiation of polymerization B. fragments of DNA polymerase I that lack 5' → 3' exonuclease activity C. short stretches of DNA formed on the lagging strand D. the smallest subunits of DNA polymerase III
What is the difference between the leading strand and the lagging strand in DNA replication? a There are different DNA polymerases involved in elongation of the leading strand and the lagging strand. b The leading strand is synthesized continuously in the 5' → 3' direction, while the lagging strand is synthesized discontinuously in the 5' → 3' direction. c The leading strand requires an RNA primer, whereas the lagging strand does not. d The leading strand is synthesized in the 3' → 5' direction in a discontinuous fashion, while the lagging strand is synthesized in the 5' → 3' direction in a continuous fashion.
(a) What is the function of helicase in DNA replication?(b) What is the function of DNA polymerase?(c) What are replication forks? Compare and contrast leading and lagging strands. Answer all please
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
Why must the lagging strand of DNA be replicated in short pieces a. Because of limited space b. To make proofreading of code easier . C. Otherwise, the helix will become distorted . D. The DNA polymerase can synthesize in only one direction
Topoisomerases are enzymes that can: a. join two DNA fragments to become one. b. catalyze conformational change of a protein. c. cut DNA at specific site. d. catalyze the breaking and rejoining of DNA strands which produces DNA that is either more or less superhelical than the original.