What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0

What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Similar questions

Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. D. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.
A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation in a cell. in the absence of this protein, the cell attempts to replicate its dna. What would happen during the dna replication process if each of the following proteins were missing?a. DNA polymerase B. DNA ligasec. Sliding clamp for DNA polymerased. nuclease that removes RNA primerse. DNA helicase F. primase
Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of DNA. However, DNA replication also requires ribonucleoside triphosphates. Why? More than one answer is correct. Question 8 options: new DNA chains are initiated on an RNA primer synthesized from ribonucleoside triphosphates by primase. DNA helicase uses the energy of ATP (a ribonucleoside triphosphate) to unwind the DNA double helix before DNA synthesis can occur. unlike DNA polymerase epsilon, DNA polymerase delta incorporates ribonucleotides into the growing polymer to synthesize the lagging strand ribonucleoside triphosphates are converted into deoxyribonucleoside triphosphates by DNA polymerase immediately before incorporation. DNA is first synthesized as RNA which is converted to DNA by removal of the 2'-OH (2' hydroxyl) from the pentose sugars in the backbone by DNA polymerase.
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Which of the following statements best describes why one of the daughter strands is synthesized in pieces? the enzymes that synthesize DNA are slower that the enzymes that unwind the double helix and this produces 'lagging time' the enzymes that synthesize DNA can only do so in a 5' --->3' direction this figure illustrates a eukaryotic cell since prokaryotic cells do not synthesize DNA…
Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. Withregard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrectpyrimidine instead of the correct pyrimidine (e. g. adding cytosine where thymine should be added) is called atransition. If a pyrimidine is incorrectly added to the growing strand instead of purine (e.g. adding cytosine when anadenine should be added), this type of mistake is called a transversion. If a transition or transversion is not detected by DNA polymerase, a mutation is created the permanently changes the DNA sequence. Though both types of mutations are rare, transition mutations are more frequent than transversion mutations. What are at least three explanations as to why this is the case?
Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
The epsilon subunit of DNA polymerase III is responsible for its _______ activity.A-5'---->3' polymerase B- Sliding clampC-3'----->5' exonuclease activity D-5'------>3' exonuclease activity
1 2 3 4 5 6 7 8 9 The gaps between the DNA fragments are sealed by DNA ligase Elongation of both the lagging and the leading strand Topoisomerase binds at the region ahead of the replication fork Primase synthesizes RNA primers RNA primers are removed and gaps are filled by DNA pol I DNA unwinds at the origin of replication DNA polymerase III starts adding nucleotides Helicase opens up the DNA-forming replication forks Single-strand binding proteins coat the DNA Arrange the processes involved in DNA replication