what enzyme is needed to make mrna

Q: The 5' end of an mRNA corresponds to the __________ end of a protein. Question 27 options: A) 5'…

A: Biological molecules are those large molecules that are found in the cells of an organism which are…

Q: How does transcription terminate? Stem loop in RNA Reaches multiple Us in RNA (multiple As in DNA)…

A: The eukaryotes and prokaryotes are living form exist on the earth. They maintain certain…

Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE

A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…

Q: what enzyme is responsible for making mrna in a cell

A: The messenger RNA or mRNA is a nucleic acid molecule that conveys the genetic information from the…

Q: Use the following segment of DNA to determine the mRNA and amino acid sequence that would form.…

A: DNA and RNA are two different forms of nucleic acids, which are biological polymers of nucleotides.…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: What is the process of Translation

A: The natural data flows from DNA to RNA, and from that point to proteins. This is the central dogma…

Q: RNA _________ Causes Gene Inactivation by Destroying the Corresponding mRNA.

A: RNA interference RNA interference(RNAi) is a mechanism that inhibits gene expression at the stage…

Q: Which enzyme adds the adenines to the 3' end of the pre-mRNA RNA Polymerase Poly(A) nuclease Poly(A)…

A: The process of addition of a poly (A) tail to the 3' end of the mRNA during its maturation is called…

Q: Blank is the enzyme that is used in transcription and blank is the enzyme used in translation

A: Introduction: Protein synthesis is the process of creating proteins from a polypeptide chain of…

Q: The process by which the information contained in mRNA is converted into a polypeptide is called _.…

A: Transcription: DNA converted into mRNA with the help of the RNA polymerase enzyme.  mRNA synthesis…

Q: Write the polypeptide sequence that would be translated from your mRNA sequence.

A: Answer -  The DNA sequence will be -  5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3'…

Q: ic code helps for protein synthesis.

A: Ribosomes are known as minute particles which consist of RNA and  the associated proteins that…

Q: 5' 3' A B. 4 3 1 2.

A: The Biochemical process by which triplet of codons on mRNA will be translated into the form of amino…

Q: If you want to decrease gene expression, you would need the activity of which RNA? O mRNA miRNA O…

A: RNA interference It is a mechanism that inhibits gene expression at the stage of translation or by…

Q: Construct an mRNA from a gene and then translate the mRNA into a protein using the genetic code

A: mRNA is produced as a result of transcription from a gene. It is a messenger RNA which is made up of…

Q: How many “letters” of an RNA molecule, in sequence,does it take to provide the code for a single…

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: in the process of transcription, _____.     mRNA attaches to ribosomes      RNA is synthesized…

A: Transcription is the cycle by which the information in a strand of DNA is duplicated into another…

Q: A portion of an mRNA molecule that determines one amino acid in apolypeptide chain is called a(n)a.…

A: Protein is synthesized from mRNA. Proteins are polymer of amino acid. 20 different amino acids are…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: How could RNAi be used medically?

A: The basic structural and functional units of life are cells. Trillions and billions of cells make up…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: what 3 parts make up processed piece of mRNA

A: A post-transcriptional modification takes place after transcription of DNA to mRNA strand in the…

Q: The largest class of introns which are found in nuclear mRNA primary transcript isa) Spliceosomal…

A: Nuclear mRNA primary transcript is a pre-mRNA which is transcribed from a gene and undergoes…

Q: 5′ capping is the first step in ________ processing.

A: Eukaryotic mRNA precursors are handled by 5′ capping, 3′ cleavage and polyadenylation, and RNA…

Q: What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA…

A: Transcription is a process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Describe how rRNA and tRNA are being processed.

A: tRNA and rRNA are structural molecules, they help in protein synthesis and they are not themselves…

Q: The information in mRNA is in a tandem array of                              , each of which is…

A: m RNA or messenger RNA is formed by the instructions given in one of the two strands of DNA called…

Q: Put the function of mRNA is blank

A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…

Q: Which macromolecule is made by the enzyme reverse transcriptase

A: Option D - cDNA

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Messenger RNA (MRNA) can be best described as: * A Chromosome that is only present in prokaryotes…

A: Messenger RNA or mRNA are single stranded RNA molecules that carries genetic information from the…

Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…

A: Codon are the triple of a base pair.

Q: In which direction in mRNA produced? 1. C terminal to n terminal 2. N terminal to c terminal…

A: mRNA:             A DNA template of nucleotide sequence is synthesized in the nucleus which owing to…

Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1

A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides.  The code is…

Q: Refer to the information on the genetic code. Use this information to determine how many amino acids…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: What protein is responsible for reading the mrna strand and creates protein(polypeptide)

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: The genetic code is Random in that the codons for the same amino acid are structurally unrelated…

A: Genetic code contains information that can be used by certain organelles to translate information…

Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: Translating mRNA C G A A U G C C G U A U U C G to amino acids

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…

Q: Each one gives some basic information and summarizes its main role in translation. mRNA:…

A: The central dogma was proposed by Francis Crick. There are three major processes: replication,…

Q: "After MRNA is made, enzymes remove introns and splice together exons in a variety of ways. This…

A: Introduction In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded RNA…

Q: What is the name of the building of an RNA molecule based on a DNA molecule?     Transcription…

A: DNA, also known by the name of Deoxyribonucleic acid is a molecule composed of two chains that coil…

Q: Discuss DNA to RNA transcription in a simple way (

A: Definition : Process of copying a segment of DNA into RNA is known as Transcription. In simple,…

Q: You know how the body using mRNA to create protein. Describe to someone how the cell will be able to…

A: mRNA vaccines instruct our cells about how to produce a protein that triggers an immune response…

Q: An mRNA that is translated into one polypeptide is called __________, while an mRNA that is…

A: Dear student answer of your question is given below:  An mRNA that is translated into one…

Q: The information in DNA is used by cells to produce proteins that perform various functions in cells.…

A: Transcription is the formation of a sequence of RNA using DNA as a template and DNA dependent RNA…

Q: The product of transcription is a polypeptide. a short piece of RNA. a short piece of DNA. a…

A: The central dogma of biology explains the flow of information from genes to protein by two…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.