What is an enzyme and what is its function?
Q: Levels of RNA structure/folding include a Secondary and Tertiary b Primary and Secondary ...
A: Ribonucleic acid (RNA) is a single-stranded nucleic acid that takes part in protein synthesis. The b...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: What is glycoproteins: Glycoproteins are molecules that comprise protein and carbohydrate chains tha...
Q: What chemical structure should be present in an amino acid or protein to give a positive Xanthoprote...
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Based on the Agarose Gel Electrophoresis results, tell in which concentration range of KCl the restr...
A: Ion-exchange chromatography separates molecules based on their charge properties. Based on charge pr...
Q: Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains it...
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...
Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).
A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is monosac...
Q: A group of BS Biology students were tasked to design and fabricate different synthetic cell membrane...
A: Several factors determine the fluidity of the cell membrane membrane like membrane lipid chemistry, ...
Q: Drawn below is a schematic of a transmembrane protein. AN Extracellular Cell membrane Cytosolic side...
A: Introduction: A membrane protein is a protein molecule that is connected or linked with the membran...
Q: Draw the structure (using chair confirmation of pyranose) of the following disaccharides. (a) 4-0-(a...
A: Disaccharides are carbohydrates that, when hydrolyzed with acids or enzymes, provide two monosacchar...
Q: Which of the following statements are FALSE? Multiple answers:Multiple answers are accepted for th...
A: Which of the following statements are FALSE? Multiple answers:Multiple answers are accept...
Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete...
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is a...
Q: Propose a reasonable biosynthesis for Compound 14. MUST BE in this order: Acetyl CoA SAM S-alanine S...
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep p...
Q: What is insulin resistance? Hypoglycemia? Hyperglycemia? Explain its similarities and differences
A: Insulin is a peptide hormone produced by the beta-cells of islets of Langerhans of the pancreas. It ...
Q: A catalase is an antioxidant enzyme that requires ferric ion for catalysis. Under conditions of iron...
A: - Option A- A prosthetic group is a non-amino acid component that is closely connected to the apopro...
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would...
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/en...
Q: In sample preparation for electron microscopy, arrange the following steps in correct order A. Apply...
A: Electron microscopy is the technique of visualising the structure of tissues, cells and organelles a...
Q: write about a Famous Case of someone with Li-Fraumeni Syndrome
A: Li-Fraumeni syndrome is a rare hereditary disorder that predisposes carriers to cancer development. ...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Km value of an enzyme
A: here they are talking about enzyme kinematics. The value of Km, app grows as the inhibitor concentra...
Q: List down the 25 different antibiotics and give the mechanism of action
A: Antibiotics, also known as antibacterials, are medications that either kill or slow the growth of ba...
Q: Enzymes
A: Enzymes are proteins that enable our bodies' metabolism, or chemical reactions, go more quickly. The...
Q: Differentiate sweet molecules in Column A using the criteria in column B.
A: Given: column A has two components which differs at different aspects as given in column B.
Q: Uncatalyzed -Enzyme A - Enzyme B C12H22011 + H,0 2C,H,,0. For the reaction shown, it can reasonably ...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions by decreasing the activati...
Q: Enumerate the main structural features of nucleosides and nucleotides
A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic aci...
Q: HIN A openvellum.ecollege.com 01+| 1叩 Assignments Review I Constants I Periodic Table Part B nts. Wh...
A: Steroids, commonly known as corticosteroids, are anti-inflammatory drugs that are used to treat a va...
Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: For beta-oxidation of an 18:1 oleate mono-unsaturated fatty acid: - How many Acetyl CoA produced? - ...
A: Fatty acids are molecules with hydrocarbon chain and carboxylic acid group. In the absence of glucos...
Q: The main role of carbohydrate in the cell membrane is ____ Select one: a. recognition b. reception c...
A: Carbohydrates are composed of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Carbohydrates are ...
Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens. ...
A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are ...
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one...
Q: What level(s) of protein structure is(are) ordinarily disrupted in denaturation? What level(s) is(ar...
A: In an amino acid-chain molecule, protein structure refers to the three-dimensional arrangement of at...
Q: Give the chemical principles involved in a positive Biuret test, Millon’s Test and Sakaguchi Test. W...
A: The color reactions of the proteins are useful in identifying the amino acids present in them. The c...
Q: explain with proper details please. Compare the net production of ATP from four molecules of glucos...
A: Glucose is a carbohydrate and it is degraded into carbon dioxide through glycolysis, pyruvate dehydr...
Q: 1.What type of bonds stabilizes the quaternary structure of proteins? * A. Peptide bond B. Electrost...
A: The structure of a protein is classified into four different levels of organizations: the primary, s...
Q: Explained how metal ions help in enzyme action. Cite three vitamins that have antioxidant activities
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/e...
Q: What are the types of genes and their functions ?
A: Introduction: Gene is a basic unit of hereditary information and it determines the inherited charact...
Q: what type of mutation can be avoided when doing the following: 1. Eating healthy foods 2. avoiding t...
A: A mutation is an alteration in a DNA sequence caused due to various factors such as exposure to ioni...
Q: Biochemistry Question: Give one example of 5-Carben Sugar
A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in ...
Q: Some of the following four amino acids : alanine, arginine, histidine, aspartic acid would provide a...
A: Acid-Base Catalysis is involved in the reaction mechanisms that requires the transfer of a proton fr...
Q: Biochemistry Question: Give one example of 5-Carben Sugar
A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in ...
Q: Enumerate the five classification of lipids based on function.
A: Lipid, any of a wide range of organic molecules that do not interact significantly with water, such ...
Q: Unfolding of a protein can be termed as a. Reduction b. Oxidation c. Denaturation d. Renaturation
A: Proteins have different levels of structural organization. They are, Primary structure Secondary st...
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: 23 Which statement describes a disease state caused by altered protein structure? OAslent mutation i...
A: Diseased state can be caused by altered protein structure. Protein can be altered by Mutations that ...
Q: Y,G,I,F,L,Y what is the biochemical propities of this residues.
A: - Tyrosine is a non-essential amino acid that the body produces from phenylalanine. - Tyrosine is an...
Q: Which of the following chromatographic techniques has an attached ligand on the stationary phase? A...
A: Chromatography is a laboratory technique that is used to separate components, or solutes, of a mixtu...
Q: Which of the following statements is FALSE? Select one: a. Secondary structure of a protein determin...
A: Amino acids are monomers of protein they are linked with each other by forming peptide b...
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclas...
A: All the mentioned components are involved in signal transduction.
Q: What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate tr...
A: Given- 1) Potential for Glucose 1-phsophate.- 20.9KJ/mol 2) potential for Glucose 6-Phosphate- -13....
Step by step
Solved in 2 steps