What is the function of single-strand binding proteins? Question options: A-bind to oriC and cause a short section of DNA to unwind B-reduce the strain (torsion) that builds up ahead of the replication fork C- connect Okazaki fragments D- prevent DNA strands from forming secondary structures or rejoining

What is the function of single-strand binding proteins? Question options: A-bind to oriC and cause a short section of DNA to unwind B-reduce the strain (torsion) that builds up ahead of the replication fork C- connect Okazaki fragments D- prevent DNA strands from forming secondary structures or rejoining

Name: Hh.136. What is the function of single-strandbinding proteins? Questio
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Hh.136. What is the function of single-strandbinding proteins? Question options:A-bind to oriC and cause a shortsection of DNA to unwindB-reduce the strain (torsion) thatbuilds up ahead of the replicationforkC- connect Okazaki fragmentsD- prevent DNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 20QP: What is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a...

See similar textbooks

Similar questions

Give only typing answer with explanation and conclusion A DNA ligase: None of the listed answers Can join two fragments of DNA binding the phosphodiester backbone with covalent bonds. All of the listed answers -not the correct answer Can recognize specific sequences that allow for the detection of SNPs. Can replicate a complementary DNA strand using a single stranded DNA template.
DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative
Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G
The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of a short segment of DNA in the __________ direction.a. missing base, 5′ to 3′b. base pair mismatch, 5′ to 3′c. missing base, 3′ to 5′d. base pair mismatch, 3′ to 5′
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase
Match each protein involved in DNA replication with its correct function in E. coli. An answer can be used more than once. Group of answer choices The major DNA replicating enzyme on both leading and lagging strands Relieves torsional stress upstream of replication forks Unwinds the double helix at replication forks Provides DNA polymerase III with a 3'-OH group paired with a DNA template Extends lagging strands at the ends of linear chromosomes Digests RNA…
What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b. the DNA strands are anti-parallel c. one strand runs 3’ to 5’ d. one strand runs 5’ to 3’ e. both strands have identical bases
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Which of the following best explains the production of Okazaki fragments in replicating DNA (a) DNA is stressed when it unwinds (b) DNA is anti-parallel and can only be synthesized 5’ to 3’ (c) DNA contains once less oxygen in its sugar while RNA has an OH attached to its 2’ carbon (d) Template strands are complementary and have a tendency to reform hydrogen bonds (e) both a and d
Which DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides? a.DNA-Pol I b.DNA-Pol II c.DNA-Pol Ill d.DNA-Pol IV