What is the isoelectric point of the peptide LIKES? Show your work below. 1-LetterACCDEFDGH1KLΣΙΖMNPORSTVQWYpK2pk side chainpk12.351.921.992.102.20 9.312.35 9.781.809.332.32 9.762.16 9.062.339.742.139.282.148.721.9510.542.17 9.131.828.992.19 9.212.09 9.102.29 9.742.46 9.412.20 9.21 10.469.8710.78.379.903.909.47 4.076.0410.5412.48

Peptide are small chain of amino acids linked by peptide bonds. Alpha carbon of amino acids consist…

Answered: What is the isoelectric point of the…

Science

Biochemistry

What is the isoelectric point of the peptide LIKES? Show your work below.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter33: The Animal Body: Basic Form And Function

Section: Chapter Questions

Problem 39CTQ: How is a condition such as diabetes a good example of the failure of a set point in humans?

See similar textbooks

Related questions

Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…

A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…

Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…

A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…

Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…

A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…

Q: Complete the reaction above by drawing the structure of PEP. Draw the molecule by placing atoms on…

A: Enolase is an enzyme that reversibly catalyze the dehydration of 2-phosphoglycerate to…

Q: Which of the following substances can deliver electrons to the ETC to help pump out H+ across the…

A: Electron transport chain is a chain of electron carriers that transfer electrons to molecular…

Q: Name the three major types of membrane lipids in animal cells and provide a specific example of…

A: The cell membrane is composed of lipids and proteins. A small amount of carbohydrates is also…

Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…

A: Introduction : Inulin - Inulin is a type of naturally occuring polysaccharide which is produced by…

Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…

A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…

Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…

Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…

A: DNA extraction involves different steps which include, the breaking of cells to open and…

Q: ● What are the three things we need to know in order to begin to understand the way an active site…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…

Q: 1. State if true or false a. Gluconeogenesis is the exact opposite of the glycolytic pathway b.…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…

A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…

Q: What is one technique or property of a protein that you could use to monitor the fractions so you…

A: In column chromatography, there is a stationary phase and the mobile phase. The stationary phase…

Q: Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need…

A: DNA consists of two strands of polynucleotide that are linked to each other via hydrogen bonding…

Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…

A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…

Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…

A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…

Q: Why can plant material be substituted? Plants contain high amounts of saturated fats. Certain plants…

A: Introduction : Linoleate - A linoleate is a salt or ester of linoleic acid(which is an organic…

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…

A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Q: What is DNA? Provide a 5-sentence long description only.

A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…

Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…

A: An oxidizing species is the substance that donates electrons, and a reducing species is the…

Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…

A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…

Q: 9.) How many grams of H₂0 must be used to dissolve loog of sucrose (C₁2H₂2011) to prepare a 0.020…

A: Mole fraction is the ratio of moles of one component in a mixture to the total no of moles of all…

Q: Among the given statements, which ones correctly describe the commonality in dopamine and…

A: The adrenal gland secretes three catecholamines-dopamine, epinephrine and norepinephrine. Dopamine…

Q: Why is a protein's structure important? What can happen if there are any changes? Provide an example…

A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…

Q: Explain the cell response to FED, and then FASTED states, by glucose transporter (GLUT)-4. (answer…

A: Carbohydrate from food is converted to glucose by digestive enzymes which then enters the…

Q: Given 2 M Tris, pH 7.1 (pKa 8.0), 5 M NaOH, 5 M HCI, and water; how would you prepare 2 L of 0.2 M…

A: Equation of dilution: M1V1 = M2V2 where: M1 is the molar concentration of the stock solution. M2 is…

Q: 1. Write a short note on transcription. What is TFBS? What is the role of RNA polymerase?

A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…

Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: 13. How would ATP production in an aerobic yeast culture change if we add the following metabolites…

A: Aerobic yeast culture is a metabolic process in which glucose is metabolize by fermentation even in…

Q: Question 9 Which of the following fatty acid does have greater solubility in wat O 16:0 O 18:0 O…

A: Fatty acids are a class of lipids that are nonpolar and are insoluble in water. The naturally…

Q: Consider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of…

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…

Q: Briefly explain the Warburg Effect. How can the Warburg effect be taken advantage

A: INTRODUCTION : Glycolysis : It is a metabolic pathway of the cells of body,in which Glucose is…

Q: 1a. Whats the difference between continuous and discontinuous synthesis? 1b. Why replication…

A: According to the semiconservative model of DNA replication proposed by Meselson and Stahl, each…

Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: Canonical forces in protein folding. Describe how these forces come into play when a protein folds.

A: INTRODUCTION : Canonical forces in protein folding - Canonical forces are those forces which…

Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…

A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…

Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…

A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…

Q: More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative…

A: Degradation of glucose is termed as glycolysis which is a catabolic pathway in which 6 carbon…

Q: The net yield of ATP for the complete oxidation of one molecule of glucose is O 10 ATP O 24 ATP O 30…

Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…

A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…

Q: What effect does a negative effector have on the graph of reac- tion rate (V) vs. [substrate] for an…

A: INTRODUCTION : Allosteric enzymes : Allosteric enzymes are those enzymes which have an additional…

Q: 3. (a) The beakers below represent different conditions for measuring the initial velocity (vo) of…

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: Among the given statements, which are characteristics of plant cells? Select the correct…

A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…

Q: Although initiation requires the sigma factor or sigma subunit be associated with the core RNA…

A: Transcription is a process by which RNA is synthesized using DNA as template. Transcription occurs…

Q: Given the following reaction below, what amino acid is involved and what is the specific reaction…

A: Phenylalanine, tyrosine, and tryptophan are aromatic amino acids. The side chain of the…

Q: What is the difference between starch and cellulose that makes one digestible and the other not…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate:…

A: Glycolysis is a process of breakdown of glucose to 2 molecules of pyruvate. This process also forms…

Q: ) How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate?…

A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…

Question

What is the isoelectric point of the peptide LIKES? Show your work below.

1-Letter
A
C
CDEF
D
G
H
1
K
L
ΣΙΖ
M
N
P
ORSTV
Q
W
Y
pK2
pk side chain
pk1
2.35
1.92
1.99
2.10
2.20 9.31
2.35 9.78
1.80
9.33
2.32 9.76
2.16 9.06
2.33
9.74
2.13
9.28
2.14
8.72
1.95
10.54
2.17 9.13
1.82
8.99
2.19 9.21
2.09 9.10
2.29 9.74
2.46 9.41
2.20 9.21 10.46
9.87
10.7
8.37
9.90
3.90
9.47 4.07
6.04
10.54
12.48

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Can you explain how to do this step by step?
When YO2 = 0.5, the value of pO2 is defined as _______ (see the graph in Model 1).
Figure 16.2 When bacteria are destroyed by leukocytes, pyrogens are released into the blood. Pyrogens reset the body’s thermostat to a higher temperature, resulting in fever. How might pyrogens cause the body temperature to rise?
How is a condition such as diabetes a good example of the failure of a set point in humans?
what does TPN means? and where do you use it for?
Hansen's disease, also known as leprosy, arises when bacteria infect the Schwann cells that wrap around axons of peripheral nerves to form a myelin .shealth. Attacks by the immune system on the bacteria-infected glial cells causes a loss of myelin in peripheral nerves. How is Hansen's disease similar to multiple sclerosis? Why do the symptoms differ? Why are people with Hansen's disease unusually prone to injuring themselves?
09 Explain the RAAS mechanism. ?
45. The molecule that leads most directly to the release of internal stores of calcium in signal transduction is a. cAMP b. ATP C. DAG d. IP, e. MAPK asap
What is the connection between the absence of HGPRT activity and the behavior al characteristic s of Lesch-Nyhan syndrome?
Mr. Jones is a pig farmer. For many years, he has fed his pigs the food left over from the local university cafeteria, which is known to be low in protein, deficient in vitamins, and downright untasty. However, the food is free, and his pigs don’t complain. One day a salesman from a feed company visits Mr. Jones. The salesman claims that his company sells a new, high-protein, vitamin-enriched feed that enhances weight gain in pigs. Although the feed is expensive, the salesman claims that the increased weight gain of the pigs will more than pay for the cost of the feed, increasing Mr. Jones’s profit. Mr. Jones responds that he took a genetics class at the university and that he has conducted some genetic experiments on his pigs; specifically, he has calculated the narrow-sense heritability of weight gain for his pigs and found it to be 0.98. Mr. Jones says that this heritability value indicates that 98% of the variance in weight gain among his pigs is determined by genetic differences,…
Cyclic-AMP stimulates which of the following? a) PKA b) PKC c) Ras d) RTK
In 2003, the Nobel Prize in Physiology or Medicine was awarded to Paul C. Lauterbur and Sir Peter Mansfield for discoveries related to magnetic resonance imaging (MRI). This is a tool to see the structures of the body (not just the nervous system) that depends on magnetic fields associated with certain atomic nuclei. The utility of this technique in the nervous system is that fat tissue and water appear as different shades between black and white. Because white matter is fatty (from myelin) and gray matter is not, they can be easily distinguished in MRI images. Visit the Nobel Prize website (http://openstaxcollege.org/l/nobel_2) to play an interactive game that demonstrates the use of this technology and compares it with other types of imaging technologies. Also, the results from an MRI session are compared with images obtained from x-ray or computed tomography. How do the imaging techniques shown in this game indicate the separation of white and gray matter compared with the freshly dissected tissue shown earlier?