More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative metabolism. True False
Q: 5. Fluoroacetate can be converted enzymatically to fluorocitrate by citrate synthase. Fluorocitrate…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate.…
Q: Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely…
A: Just as a high temperature can denature protein, nucleic acids such as DNA and RNA can too be…
Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…
A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…
Q: How to draw titration of amino acids ？what happen when ph increase from low to high？ 1. what does it…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…
A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Anaerobic pathways after glycolysis In the absence of oxygen, what anaerobic pathways can occur…
A: Introduction Glycolysis is a metabolic pathway where one glucose breaks and forms 2 molecules of…
Q: Which of the following is true under the following conditions: an enzyme displaying Michaelis-Menten…
A: Enzymes are protein molecules that increase the rate of reaction by million times. Enzymes do not…
Q: Mixtures of amino acids can be analyzed by first separating the mixture into its components through…
A: In ion exchange chromatography the column support matrix is constituted of beads to which charged…
Q: Human proteins are made up of ______________ (number of distinct/unique) amino acids.
A: Proteins are made up of amino acids attached together via peptide bonds. The proteins can fold up…
Q: What is the net ionic charge for the peptide at pH 5 and pH 11? The peptide is…
A: A peptide is a short chain of amino acid residues linked via a peptide bond. As a general rule of…
Q: What cell phases do the alkylating agents work on? a)S phase b) G0 c) G1 d) G2 e) M phase
A: Anticancer drugs may be divided (on the basis of stage of cell cycle at which these act) into two…
Q: How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Which of these are components of animal fatty acid synthase (FAS)? B-ketoacyl reductase enoyl…
A: The majority of healthy human tissues primarily create new structural lipids from circulating…
Q: Given the R-groups in the peptide GLY-ASN-THR-LYS-HIS. It would most likely be: a)neither soluble…
A: Different amino acids have different R-groups. The R-groups can be polar or non-polar. Polar…
Q: Calculate the net charge on the following tripeptides at pH 5.0: (a) Leu-His-Asp [0] (b)…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Please answer fast draw pyruvate carboxylase mechanism. cofsctors must include. label all…
A: Pyruvate carboxylase is an enzyme which catalyzes the conversion of pyruvate to carboxylase.…
Q: List the ways in which intact endothelium prevents clotting 6) Know the functions of the coagulation…
A: Coagulation or clotting is the mechanism by which liquid blood changes to a gel like form.…
Q: H3C CH3 -(HC- H₂ H₂ -C-C -CH2)3- Pristanic acid CH3 IL.
A: Pristanic acid is a branched chain fatty acid . It is 2,6,10,14 tetra methyl Penta decanoic acid.…
Q: 7. Isocitrate dehydrogenase is inhibited by ADP and activated by ATP. T F
A: Isocitrate dehydrogenase catalyzes the oxidative decarboxylation of isocitrate to…
Q: DNA: Whats the structural and functional differences between heterochromatin and euchromatin?
A: DNA, the genetic material is organized as chromosomes inside the cell nucleus. The chromosomes have…
Q: Question 24 of 25 Given the following reaction below, what amino acid is involved and what is the…
A:
Q: In biochemistry，what is the main function of amide group and carboxyl group on amino acids？which one…
A: Proteins are made up of amino acids. When few amino acids are joined, the formed structure is called…
Q: Phosphatidic acid phosphatase (PAP), also called lipin, converts phosphatidate to diacylglycerol…
A: Phosphatidic acid phosphatase (PAP) or lipin converts phosphatidate to diacylglycerol (DAG), while…
Q: 9.) How many grams of H₂0 must be used to dissolve loog of sucrose (C₁2H₂2011) to prepare a 0.020…
A: Mole fraction is the ratio of moles of one component in a mixture to the total no of moles of all…
Q: 7. Vitamin B₂: coenzyme form, functional groups, mechanism of action, biological role, sources,…
A: The vitamin B complex is a set of water-soluble vitamins that includes riboflavin, commonly known as…
Q: 2. How many grams of glycerine, C3H5(OH) (MM = 92 g/mol) is mixed with 36 g H₂O to make a solution…
A:
Q: The gels we will be using for electrophoresis during the next lab consist of 1% agarose. Suppose you…
A: There are different ways to denote the concentration of a solution. Per cent (w/v) means there is 1…
Q: Please answer fast What types of interactions likely promote the dimerization of a protein?
A: Proteins are polymers of amino acids that are joined together through peptide bonds. A peptide is a…
Q: Select ALL of the following that are made during the Kreb's Cycle. ATP CO₂ NADH FADH2
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: An egg placed in boiling water becomes hardboiled in 3 minutes. What changes have occurred in the…
A: All proteins have three levels of conformations known as primary, secondary, and tertiary.…
Q: 6. Study the cycle below and answer the following 6.1 Provide a definition for the citric acid cycle…
A: - The Krebs cycle, also known as the TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle,…
Q: 4) For various amino acid pairs (for example: F to A, E to R, D to N, V to L, S to W), ask yourself:…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…
A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…
Q: What should we do to prevent ourselves from toxic exposure?
A: Many chemical / biochemical species and radiations can have adverse effects on human beings . Some…
Q: a. Provide names for both metabolites. b. What kind of reaction occurs here? c. What enzyme…
A: Biochemical reactions are catalyzed by enzymes in which bio-metabolites are transformed into another…
Q: Fill in the blanks: What occurred in the reaction, Sn4+ → Sn²+ A. oxidation B. reduction B.…
A:
Q: Triacylglycerols Store Energy Q4.3 - Describe the three sources of triacylglycerols in humans and…
A: Introduction: Triacylglycerols are also known as neutral fats or triacylglycerides, which are esters…
Q: CASE STUDY 9.5, PART 2 Recall Myra. Her mother was contacted by the EMTS, and she mentioned that her…
A: Diabetes mellitus is a clinical condition characterized by hyperglycemia and high blood sugar…
Q: Sketch on one reaction rate vs. substrate concentration graph & sketch on one Lineweaver-Burk type…
A: LB plot is double reciprocal plot which gives Km and Vmax values as x intercept and y intercept…
Q: In the peptide, HAPPYNEWYEAR, there are a total of removed in its formation. (Write the symbol of…
A: A peptide is a polymer of amino acid residues linked via a peptide bond. A peptide bond is a…
Q: What differences would you expect in the structure of a membrane bound protein versus a cytosolic…
A: A protein molecule must fold into its appropriate three dimensional structure in order to become…
Q: Which of the following statement about the enzyme thermodynamics is TRUE? a. Enzymes increase…
A: Introduction Enzymes are known as bio-catalyst. All the metabolic reaction of our body is enzyme…
Q: The pKa of the Histidine side chain is 6.0. When Histidine is dissolved in a buffer with pH 5.0, the…
A: A molecule's level of acidity is indicated by the pKa value. A proton's grip on a Bronsted acid is…
Q: 15.5 Identify the acid-base conjugate pairs in each of the following reactions: (a) CH₂COO + HCN (b)…
A: An acid is defined as the donator of protons and a base is defined as the acceptor of protons. Acid…
Q: Explain the molecular basis for animal fat being solid at room temperature but vegetable oil being…
A: Lipids is a term used of chemically diverse group of biomolecules that have two things in common:…
Q: Which pathways use substrate-level phosphorylation and which use oxidative phosphorylation?
A: Substrate-level phosphorylation is a metabolic process that involves the direct transfer of a…
Q: A one-to-one protein (P)-ligand (L) complexation (P + L PL) has a equilibrium constant (Kd) value…
A: ∆Cp is the heat capacity at constant pressure. ∆S is change in entropy, degree of randomness. At…
Q: what is the concetration of a lysozyme solution with an absorbance of 0.720 measured at 280 nm(…
A: Measuring the concentration of a substance in solution on the basis of its absorbance forms the…
Q: Identify the different functions of the genes coded in the lac operon region.
A: Operon is a set of linked genes that codes for proteins that are functionally related. lac operon is…
More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative
True
False
Step by step
Solved in 2 steps
- The conversion of 1 molecule of fructose into 2 molecules of pyruvate produces the same amount of net ATP as the conversion of 1 molecule of glucose released from glycogen into 2 molecules of pyruvate true or falseMost of the ATP produced during cellular respiration is produced during glycolysis. True or FalseWhen glucose goes through the steps of cellular respiration, the overall process can be summarized as the oxidation of glucose. True False
- The citric acid cycle will be most active when the ATP/ADP ratio is high. True or falsefatty acid store potential energy that can be used to create ATP in the Krebs citric acid cycle true or falseThe Km of liver glucokinase is _____ than typical blood glucose concentrations. At typical blood glucose concentrations, therefore, the rate of glucose catabolism in liver cells is relatively ____. Much higher; fast Much higher; slow Much lower; fast Much lower; slow
- A glucometer measures the electrical current produced by the redox reaction catalyzed by glucose oxidase, which converts gluconolactone to glucose. True FalseIts principal function is to increase the concentration of glucose in the blood by speeding the glycogenolysis and gluconeogenesis in the liver.Why does epinephrine stimulate glycolysis? I know why epinephrine stimulates glycogenolysis which is to release glucose stores. But epinephrine stimulating glycolysis seems counterintuitive as it would synthesize less glucose and more pyruvate?
- Assume that glycolysis is completely inhibited and thus glucose cannot be converted topyruvate. Which of the following statements is true?A. Levels of acetyl-CoA decrease in the liverB. Levels of oxaloacetate increase in the liverC. Both liver and brain primarily use b-hydroxybutyrate and acetoacetate as energy sourceD. None of the aboveFor an individual whose liver is regulated to have gluconeogenesis on and glycolysis off, when energy is needed - what is the major carbon source used to produce acetyl CoA? a. amino acids b. glyoxylate c. glucose d. fatty acidsAs a protective mechanism, when this cellular ATP drops, the body takes the fructose and breaks it down for storage as ________________ and ________________.