Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Making your D.I.Y Herbarium. 1.) How do MRI’s work
A: Herbarium simply consists of dried plant species mounted on a peice of paper. These plant species ar...
Q: What is Cot analysis? Do the Cot renaturation curves for a virus, bacterium, and yeast all roughly c...
A: C0t analysis, which is based on the principles of DNA reassociation kinetics, is a biochemical techn...
Q: QUESTION 4 Which of the following is NOTa part of an inflammatory response? O Edema Histamine releas...
A: Inflammation: it is a natural immune response of the body against harmful agents. Inflammatory respo...
Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer
A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a double-stran...
Q: which climate related factors shape biomes and how might they affect which organisms live in a parti...
A: ANSWER;- Climate includes temperature and precipitation, and it decides the developing season and so...
Q: What are the factors which need to be considered in the selection of culture vessel?
A: Culture vessels:- Culture vessels provide a contamination barrier to protect the cultures from the e...
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: Which of the following is true about the movement of ions across excitable living membranes? Ions...
A: Introduction :- The thin layer that forms the outer edge of a living cell or a cell compartment with...
Q: analysis of eukaryotic cells and how they differ from prokaryotic cells.
A: Eukaryotic cells include plant cells and animal cells and they differ from each other by the presenc...
Q: An epitope associates with which part of an antigen receptor?
A:
Q: . Identify the phases of mitosis depicted in Figure 3-7 by inserting the correct name in the blank u...
A: Cell division is defined as the process by which cell multiply and involve nuclear as well as cytopl...
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: Insects are adapted their environment in many ways. An adaptation is an adjustment to the environmen...
Q: Animal Kingdom Do not possess a backbone Possess a backbone Asymmetric, Bilateral symmetry, Four lim...
A: *Invertebrates are the animals do not posses backbone. *Vertebrates are the animals that posses back...
Q: n not more than 7 sentences, discuss briefly the techniques used in microscopic examination of stool...
A: Human feces is also called as Stool. It is the waste residue of indigestible materials that are thro...
Q: What are the two main types of transport proteins? What are their functions?
A: The act or means by which a molecule or ion is transferred across the cell membrane or through the b...
Q: How has having an opposable thumb helped primates, especially humans, adapt to their environment and...
A: The opposable thumb is an adaptation that helps humans and other primates to carry out the tasks the...
Q: When you make a gene to put into another organism, you need to combine the __________ sequence at th...
A: Answer: The transfer of new gene into another organism usually by vectors such as plasmids, and modi...
Q: Chromosome abnormalities can be structural or numerical. Enumerate at least 3 examples of each, givi...
A: Numerical chromosomal abnormalities occur when there is a different number of chromosomes in the cel...
Q: How is a knowledge on the origin of the insect alimentary canal assists one in understanding each di...
A:
Q: upper motor neurons: lower motor neurons
A: Answer- option D- UPPER MOTOR NEURONES AND LOWER MOTOR NEURONES.
Q: The common garden pea (Pisum sp.) can have green or yellow pea pods. Green peas are either homozygou...
A: Introduction Heterozygous means that you have inherited different versions of a gene from each paren...
Q: Please match the Arthropod subphylum or class to the description. two pairs of antennae [ Choose ] [...
A: Arthropoda is a largest phylum in Animal kingdom.
Q: What does the Calvin-Benson cycle produce? What molecule is "fixed" in the reactions of the Calvin B...
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby guidelin...
Q: Which of the following are used for mechanical digestion? A. Pancreatic juice B. Saliva C. Bile D. H...
A: Introduction:- The digestive system of the human body is made up of a collection of organs that work...
Q: Identify and explain the process by which cells expel materialsin bulkb
A: The movement of chemicals through the cell membrane is referred to as cell transport. The ability of...
Q: What type of tissue is the heart made out of
A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...
Q: Mendelian Genetics The presence of a dimple on the cheek is governed by a dominant gene. A couple h...
A: Heterozygous means that you acquired different versions of a gene from each of your parents. A heter...
Q: Why are some amino acids called essential?
A: Amino acids are the organic components that will unite to produce a protein. They serve as the found...
Q: In a short personal essay, what is the ultimate purpose of human life
A:
Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe
A: Introduction A chemical reaction is a process in which the reactants are converted into a product w...
Q: As a historical thinker wondering about cause and consequence, ask yourself questions such as these:...
A: The world war 1 which lasting from August 1914 to November 1918, had a huge effect on Canada. In th...
Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...
A: Answer:- An allele is the alternative and variant form of a gene, which is located on the same loc...
Q: A 65-year-old man presents with facial weakness. He says he noticed that his face appeared twisted w...
A: Facial nerve schwannoma : it is Benign peripheral nerve sheath tumor that arise from Schwan cells. ...
Q: A young boy is color blind. His one brother and five sisters are not. The boy has three maternal unc...
A: Introduction: Colour blindness, also known as colour vision deficit, is the inability or reduced cap...
Q: "Dietary restriction has been shown to have several health benefits including increased insulin sens...
A: The conventional method of dietary control was believed to be dietary restriction of caloric intake....
Q: The concentration of RNase that Christian Anfinsen used in his denaturation/renaturation experiments...
A: Anfinsen's work demonstrated that the native structure of ribonuclease will form after denaturation ...
Q: In peas, grey seed color (G) is dominant to green (g). The following data were collected. Indicate t...
A: In a heterozygous condition, the dominant trait is expressed, while for a recessive trait to express...
Q: Flow cytometry analysis was performed on the blood of an individual known to have been recently expo...
A: Rhino virus: it causes common cold, pneumonia in children. Mycobacterium: it causes tuberculosis. I...
Q: mutation on HIV replicatication
A: Human immunodeficiency virus = HIV
Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding dau...
A: DNA is molecule which is present inside a cell and contain the genetic information of an individual ...
Q: embryos are exposed to this drug during an early stage of organogenesis, they develop severe skeleta...
A: Hox genes are involved in embryonic development as well as in mechanisms in the adult body , thus it...
Q: Identify the Bryophyte and if it is in its haploid or diploid reproductive state. A hornwort Haploid...
A: Bryophytes are categorised into three groups of embryophytes(non-vascular plants) these are: Liverw...
Q: How did the energy-related organelles arise?
A: The energy-related organelles in eukaryotes are chloroplast and mitochondria.
Q: Molecule #3 a)What Group? (Carb, Lipid, Protein, or Nucleic Acid). b)Within the group, how would you...
A: Introduction: Males' main sex hormone is testosterone. It is a steroid hormone produced by the leydi...
Q: Relate the edaphic factors and Climatic factors with the type and abundance of vegetation and other ...
A: Answer : the edaphic factors which relates to the type and abundance of vegetation and other organis...
Q: The _ is the region that triggers hunger in response to signals from nerve cells and messages carrie...
A: Hypothalamus Its forms the lower or ventral part of diencephalon. It lies at the base part thalamus...
Q: Does the type of diet of the insect affect the structure of organs/parts of the digestive system? Ci...
A: The insect digestive system is a closed one with one long enclosed coiled tube called the alimentary...
Q: 4 F E 10 D 11 13 A- B
A: Answer: A: Ovary B: Egg/Egg Cell/Egg nucleus C: Synergids D: Polar nuclei E: Antipodal cells F: Po...
Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...
A: The 4 classes of macromolecules are - carbohydrate Lipid Protein Nucleic acid Carbohydrate pr...
What is the most sclerotized insect head? Why?
Step by step
Solved in 2 steps
