What is the resulting polypeptide: _______________________________________________________? +b My Questions | bartlebyLab 9 DNA.docO https://moodle.isothermal.ed xO Lab Interactive: Mutationsn Course: 2021FA BIO 275 700 xA Not secure | lab.concord.org/embeddable.html#interactives/sam/DNA-to-proteins/4-mutations.jsonAboutShareDNA SequenceEnter DNA sequence belowOriginal sequenceATGGCAGGCGGCGAGAGCTTGCTAATTGGCTTATAGATGGCAGGCGGCGAGAGCTTGCTAATTGGCTTATAGEdited sequencelleLeu LeuApplyLeuGly Gly SerAlaMet GluEdit DNAClick on a nucleotide to perform a mutation orTranscribeTranslateShow proteinShow DNAStart/continue modelStopResetContinue one stepThe ConcordConsortium

Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…

Answered: What is the resulting polypeptide:…

Science

Biology

What is the resulting polypeptide: _______________________________________________________?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Related questions

Q: Describe the molecular make-up of an ATP molecule and explain its role in the body. Please be as…

A: The molecular make-up of an ATP molecule Adenosine triphosphate (ATP) is a nucleoside…

Q: Read this article and answer the following question There are 3 different Metformin ER products…

A: There are mainly 3 forms of Metformin ER products available which are: Glucophage XR Glumetza ER…

Q: а. b. trans-cyclodecene (R)-cysteine H HS. or H3N' H. or (S)-cysteine С. d.

A: R system of naming an enantiomer follows clockwise order i.e Highest priority group to the left and…

Q: Write down the abbreviations (both 1 letter and 3 letter) for the amino acids given below:…

A: Amino acids contain an alpha-carboxylic acid group and an alpha-amino group. Glycine is the simplest…

Q: Please draw the Pharmaceutical label(Manufacturer lebel) and highlight the parts ,drawing should be…

A: A manufacturer's label on pharmaceutical products provides all the relevant information about the…

Q: Make a dichotomous key for beauty product or cleaning agent.at least 10 items. plse this is the…

A: A dichotomous key is a significant instrument, used to recognize various living beings or things,…

Q: Help me What information about the drug should you determine prior to administration?

A: Nurses are essential in the administration of medication to clients. The nurses may administer…

Q: What are genetic disorder that cause by the following substances/product? Just give one genetic…

A: As per our policy we are answering the first question only. Rest of the question kindly repost the…

Q: ER 1ZER TIZER GEL

A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…

Q: he doctor ordered Ancef 225mg IM every 8 hours. You have on hand a 1 gram vial with the…

A: It is important for patient safety that you should accurately calculate an appropriate dose of a…

Q: Write a sentence (minimum of 5 sentences, maximum of 8) about Covid-19 with an argumentative…

A: 1):- covid -19 is an infectious disease caused by the newly discovered coronavirus.it was first…

Q: What are the derivatives of the palatoquadrate? Duscuss.

A: Paeloquadrate is present in the dorsal region of the mandibular arch.It is the structure present…

Q: identify the question being asked IUPAC name for C16:0

A: The IUPAC nomenclature of organic chemistry is a technique of naming organic chemical compounds that…

Q: What is the answer?

A: Membrane transport is an important phenomenon for the movement of ions, molecules and nutrients…

Q: Write the introduction, pharmaceutical information and action of Procainamide? Please answer at your…

A: Procainamide: It is a drug that is used to treat and manage: -Wolf-Parkinson-White…

Q: The PEPTIDE shown has the amino acid sequence: Lys-Glu-lle-Ser-Val Val-Asp-lle-Glu-Arg…

A: A linear sequence of amino acids forms the primary structure of a protein molecule. The major…

Q: HO HO [Select] terpene triacylglycerol steroid glycolipid ОН но HN НО

A: There are different types of lipids known as phosphoglycerolipids, sphingolipids,…

Q: Could any one please help me with this ? I am making notes on diagrams. I want someone to describe…

A: Consonant is a speech sound produced by movement of air.

Q: Branched- Aromatic Chain Phenylalanine Tyrosine Cystine Cysteine Amino Amino Acids Acids Black-Urine…

A: Black urine disease: phenylalanine , tyrosine, aromatic amino acids Cystinuria: cystine Maple syrup…

Q: 2. A pharmacist has 50mL of 2.5%w/v solution of Benoxinate hydrochloride (E-value 0.11). What is the…

A: Given, 50 mL of 2.5% w/v of Benoxinate hydrochloride E value is given = 0.11 To calculate tonicity

Q: Give a clear handwritten answer with explanation.....give detailed answer. what is standard amino…

A: Proteins are a class of complex macromolecules essential for the human body. Proteins are formed by…

Q: What is Zellweger's syndrome?

A: Zellweger's syndrome is known as cerebrohepatorenal syndrome.

Q: The doctor orders 4mg of IM lidocaine every 3 hours for your patient's pain. The drug is available…

A: Order given = 4mg Available dosage = 10mg/mL. Assuming the drug to be wasted per dose of 4mg IM

Q: Identify the sequence of the peptide below. H CH2 CH,…

A: The peptide bond is formed between carboxyl group of one amino acid and amino group of other amino…

Q: Rx Of oxacinophtalmic solution 3% Disp. 10 mL How many milligrams of axacin contained in each…

A: In the health sector, it is the responsibility of the nurses to administer the drugs to the patient,…

Q: Explain in 3 paragraphs (250-300 words) only need answer ASAP Explain why is there a need for…

A: Biochemistry is the study of science which includes biology and chemistry about the chemical…

Q: Michelle's doctor orders 0.044 g of chlorpromazine, which is used to treat nausea. If the stock…

A: 1 gm is equivalent to 1000 milligrams. Hence,

Q: a short not on insoluble polymer matrix system of modified dosage form. question is related to…

A: This matrix system was the earliest oral extended release platform for medicinal use , here the drug…

Q: How many amino acids are in the following peptide? H₂N H3C ZI CH3 IZ O=C CH3 `N H HH OH | LOH

A: A polypeptide chain constitutes of amino acids are linked together via peptide bonds. The proteins…

Q: Also Please explain each shapes represent what, thanks

A: The mortality rate or the death is the measure of the number of death and the natality rate is the…

Q: Give the functions of the following ingredients, then name a branded/commercial skin or hair care…

A: Ozokerite wax is dark brown or light yellow color mineral wax. It is made up of carbon and…

Q: How would you make a cup of coffee using this coffee beans? Explain your answer.

A: Coffee beans Coffee beans are the seeds of coffee plants that are used to make coffee from it. It is…

Q: please match the following with the right answer here are the option

A: Solution that destabilize the cell wall/ membrane of the bacteria :- Ice bath Protein that gives the…

Q: Treatment of isovaleric aciduria : a. Arginine b. Lysine c. Glycine d. Methionine

A: Isovaleric aciduria occur due to defective catabolism of leucine due to deficiency of enzymes…

Q: Draw the molecule. B-D-Gal(1 → 3)ß-D-GlycNAc Ta(1 →2) L-Fuc

A: Fucose has the chemical composition C6H12O5 and is a hexose deoxy sugar. It is located on the…

Q: UNSCRAMBLE THE WORDS 1. ( M C A L R A G D O ) 2. ( B E Y O L M R O Y G ) 3. ( N E T A P Y O G O L…

A: The study of links between various groups of species and their evolutionary development is known as…

Q: Name each amino acid below with only their full name and the three-lever abbreviation. Submit your…

A: Amino acids are building blocks of proteins. They are 20 standard amino acids that are classified…

Q: which of the following is/are the symbol or abbreviation of approximately? Select one: O ca. all are…

A: Abbreviations and symbolic depictions in a mathematical equation or test related to numerals is a…

Q: Nortriptyline What volume should you administer? Please give your answer as a whole number is…

A: Nortriptyline is a type of drug that is usually used to treat cases of nerve pain. It is also used…

Q: Answer the following questions about Glipizide. 1. Classification (Chemical and Therapeutic) of the…

A: Glipizide is a drug that is used for the treatment of type 2 diabetes mellitus. It helps in the…

Q: 31

A: A phosphate group, a 5-carbon sugar ring (ribose/deoxyribose), and a nitrogenous base make up the…

Q: Which of the following amino acids is/are ketogenic? A. tyrosine and phenylalanine B.lysine and…

A: A carboxylic acid group, a side-chain distinct to each amino acid, and an amine group are the three…

Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…

A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…

Q: identify the structure that IMMEDIATELY FOLLOWS the structure indicated by the X's

A: The nephron is the basic functional and structural unit of the kidney. It consists of the tubule and…

Q: Discuss the function of Rubisco. Please explain in 5 sentences or less! Thank you

A: RuBisCo enzymes acts as both carboxylase and oxygenase.Hence it is a primary enzyme that acts in the…

Q: Do not understand how to solve this? Please explain & assist

A: It is defined as the moles of an acid or base necessary to change the pH of a solution by 1,divided…

Q: What are four Rs

A: The four Rs are required to be eco friendly. For living a sustainable lifestyle, we can use these…

Q: Explain how to determine the molarity of a potato. Please write from 3-8 sentences only.

A: Molarity describes the concentration of a solution. Molarity= Moles of solute / liters of solution…

Question

What is the resulting polypeptide: _______________________________________________________?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Can somone check my answers are in bold please for both questions :Which is NOT true of the different conformations of DNA? A. Z-DNA is a left-handed spiral. B. Both A-DNA and B-DNA are dehydrated. C. A-DNA and B-DNA are right-handed spirals. D. A-DNA and Z-DNA segments are limited to short regions of DNA. For double-stranded DNA, consider the following base ratios: A/G C/T C/G (A+C)/(G+T) (A+G)/(C+T) (A+T)/(G+C) Which of those ratios always equals 1? A. 3, 4, and 5 B. 3 and 6 C. 1, 4, and 5 D. 4 and 6 E. 1 and 2
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.