What molecular biology strategy can best be used to determine Inhibition of DNA synthesis? Explain.

Q: Define exon shuffling and explain why its occurrence might be an evolutionary advantage.

A: Gene expression is the process by which the instructions in the DNA are converted into a functional…

Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…

A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…

Q: could Nirenberg and Matthaei have substituted RNA polymerase instead of polynucleotide phosphorylase…

A: The scientist Marshall Nirenberg and Heinrich J. Matthaei designed an experiment to elucidate the…

Q: How might 32P and 35S be used to demonstrate that the transforming principle is DNA? Briefly outline…

A: Genome is referred to as the genetic material of an organism that can be DNA or RNA(viruses). The…

Q: In the treatment of cancer, the basis for many types of chemotherapyand radiation therapy is that…

A: The tumor is irregular growth of tissue. It is the first stage of tumor development. The…

Q: Do the results shown in this figure support the claim? Explain, being specific about what evidence…

A: The bacterial CRISPR-Cas9 immune system is a powerful and versatile genome-editing tool. It holds…

Q: The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find…

A: The function of the yeast two-hybrid system It is based on the fact that the activating and binding…

Q: In your own words, describe three different, specific challenges to genetic transformation in…

A: Genetic transformation integrates DNA into the cells of the target organisms. To identify these…

Q: What molecular biology strategy can best be used to determine Inhibition of the splicing of one…

A: In eukaryotic genes, introns exist. They are interstitial sequences (80-10,000 bp). They do not code…

Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......

A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…

Q: Explain the difference between sequencing by chain termination and sequencing by synthesis. Which…

A: Chain termination process employs dideoxynucleoside triphosphates (ddNTPs) lacking OH (hydroxyl)…

Q: (Reasoning) What are two discovered uses of noncoding DNA (introns)?

A: Introns are non coding DNA sequences which do not encode for proteins.

Q: It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a…

A: DNA polymerase is defined as the family of enzymes responsible for catalyzing the synthesis of new…

Q: Close contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals…

A: DNA polymerases are the enzyme that replicates DNA in cells. DNA polymerase can not create new…

Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…

A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.

Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…

A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…

Q: Gel electrophoresis drives DNA along an electrical current from a negative electrode to a positive…

A: Gel electrophoresis is a technique used to separate and analyze macromolecules such as RNA…

Q: Explain why NTPs are used in DNA synthesis, rather than NDPs?

A: Four deoxyribonucleotide triphosphates (dNTP's) are required for Deoxyribose Nucleic Acid (DNA)…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: Explain why genomic DNA libraries require more colonies than are comprised by a single genome…

A: Genes are the units of heredity that are transmitted through generations. Genes contain the genetic…

Q: 33. Genes for medically important proteins can be cloned and inserted into bacteria, as shown in the…

A: Recombinant DNA is a technique discovered by scientists that allows a human gene to be inserted into…

Q: Why does it make biological sense for RNA synthesis in vivo to be less accurate than DNA synthesis?

A: Transcription or RNA synthesis is the process of conversion of DNA nucleotide sequence into RNA by…

Q: DNA isolated from an organism can be sheared into fragments of uniform size (∼1000 bp), heated to…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: The overall structures of RNA polymerase and DNA polymerase are very different, yet their active…

A: DNA polymerase help in DNA replication whereas RNA polymerase help in transcriptions. Both have…

Q: Why is it important that Telomerase synthesizes the repeat DNA in the presence of the shelterin…

A: Telomere  Telomere is a end of chromosome consisting repetitive sequence of non coding DNA.

Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?

A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…

Q: a. Propose three different mutations to prevent initiation, elongation, and termination of bacterial…

A: Mutations: Mutations are caused due to alterations in the DNA sequence possibly affecting its…

Q: Describe the central dogma of molecular biology.With regards to DNA, what is supercoiling and what…

A: Replication is the reason for organic legacy. It duplicates a cell's DNA. The chemical Deoxyribose…

Q: Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features:…

A: Introduction: DNA polymerases are the group of enzymes that catalyze the synthesis of DNA strands…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…

Q: Suppose that a replicative DNA polymerase had its 3′ exonuclease site 1.5 nm from the polymerase…

A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…

Q: using example what is a degenerate primer? with the aid of diagrams discuss how degenerate primers…

A: A degenerate primer is defined as: "A mix of oligonucleotide sequences in which some positions…

Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…

A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…

Q: describe the normal role of the component, and choose from the selection the most direct effect of…

A: Introduction :- DNA is the genetic material of the cell . It stores all the hereditary information (…

Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…

A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…

Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…

A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…

Q: Does the Hershy-Chase experiment distinguish between DNA and RNA as the molecular serving as the…

A: Hershey and Chase demonstrated that nucleic acid is the genetic material. DNA is a double-stranded…

Q: Explain why two bound metal ions at the palm domain of DNA polymerase play an important role during…

A: DNA polymerase is an important enzyme of cellular replication machinery that functions to replicate…

Q: Imagine a bacterial cell with a mutation that renders helicase completely nonfunctional (note that…

A: Replication: Replication is the process to copy old DNA  into new DNA strands (genetic material),…

Q: describe the normal role of the component, and choose from the selection the most direct effect of…

A: Introduction :- DNA is synthesized through the process of DNA replication, during the S phase of…

Q: How would you modify the Ames test to evaluate physical mutagens?Would it be necessary to add the…

A: Physical mutagens involve the radiation like ultraviolet rays, X rays, gamma rays and alpha and beta…

Q: Many of the gene products involved in DNA synthesis wereinitially defined by studying mutant E. coli…

A: DnaE gene is involved in the formation of phosphodiester bond between nucleotides, whereas DnaQ gene…

Q: Explain why the active site of poly(A) polymerase is much narrower than that of DNA and RNA…

A: Poly (A) polymerase is the enzyme that is an important part of the polyadenylation machinery. It is…

Q: DNA polymerases cannot act as primers for replication, yet primase and other RNA polymerases can.…

A: DNA polymerases are the enzymes that catalyze the formation polynucleotide chains by the addition of…

Q: Why is electrophoresis important in Molecular Biology

A: The elctrophoresis is a general term that depicts the migration and partition of charged particles…

Q: • Deletion chromosomes are useful for what purpose?

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.