What must be translated using the Genetic Code Table to decode a specific type of amino acid that will comprise the polypeptide chain? complementary base pair of MRNA anticodon of tRNA codon of MRNA template of DNA strand in the nucleus

What must be translated using the Genetic Code Table to decode a specific type of amino acid that will comprise the polypeptide chain? complementary base pair of MRNA anticodon of tRNA codon of MRNA template of DNA strand in the nucleus

Name: What must be translated using the Genetic Code Table to decode aspeci
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What must be translated using the Genetic Code Table to decode aspecific type of amino acid that will comprise the polypeptide chain? *complementary base pair of mRNAanticodon of tRNAcodon of MRNAtemplate of DNA strand in the nucleus

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 4QP: If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
What would be the effect on reading frame and gene function if:Answer each Two bases were inserted into the middle of an mRNA? Three bases were inserted into the middle of an mRNA? One base was inserted into one codon? Two codons were subtracted from the first codon?
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’.
The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?
Construct a polypeptide chain by translating the given red strand of the mRNA segment. AUG-ACA-GUG-UCA-UAC-AAG-CCU-CAU-GCC-GUC-AUA-CUU-GGG-UGU-GAC-CUA-AUA
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
What is the lagging strand sequence if the leading strand of DNA is TTA CCG ATC GAA? How many amino acids can be identified if the coded mRNA sequence is GCAUUACAUGGCGGA
Gene Expression: Illustrate some steps involved in RNA processing and identify the sequence of amino acids in a polypeptide chain corresponding to the codons in the mRNA. Procedure and Questions: The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. 1. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2. Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends. 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: Codon: Anitcodon: Amino Acids: