Answered: What possible solutions can be used to…

Science

Biology

What possible solutions can be used to address the problem of freshwater crocodiles became endangered?

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter8: Management Practices For Alligators, Frogs, And Plants

Section: Chapter Questions

Problem 3E

See similar textbooks

Related questions

Q: What would happen to a polarized epithelial cell tissue if we added a calcium chelating agent…

A: Answer : if we assume calcium chelating agent externally to a polarized epithelial cell tissue then…

Q: When is a tetrad specifically formed? Would it be found in a haploid or diploid cell? What event…

A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…

Q: Axons in the nerves. a. increase the surface area of the cell b. receive signals from neighboring…

A: Axons are the part of nerve cell or neuron.

Q: Glycolysis produces_____and_______through oxidizing_____ and ____ choose from the following:…

A: Glycolysis Occurs in cytoplasm. Common phase for aerobic and anaerobic respiration. It involves a…

Q: Which of the following genetic mechanism isn't used by bacteria in the transference of genetic…

A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…

Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?

A: INTRODUCTION The process of copying a segment of DNA into mRNA known as transcription. In the DNA…

Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:

A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…

Q: How is RNAPol recruited to the correct place along the DNA to begin transcription at the +1 site?

A: Site of DNA where first nucleotide is transcribed is termed as +1 or initiation site.

Q: What does it mean to say that action potentials are “all or none”?

A: Introduction :- A depolarizing current causes an explosion of electrical activity, which is known as…

Q: number 32

A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…

Q: Why are urinary tract infections such common healthcare-associated infections? Conduct additional…

A: Answer

Q: can you Illustrate and explain a back crossing

A: Backcrossing can be defined as a crossing of a hybrid with one of its parents or with an organism…

Q: Chemical communication is one of the most widely used means of communication among insects. How do…

A: To give How Pheromones affect on insect behaviours Types of pheromones Example of insect

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Which of the following bacteria can survive in in temperatures ranging from 39°F (4°C)---to 99°F…

A: Bacteria are single-celled microorganisms that can be found in every environment on Earth. They are…

Q: Which anatomical skull structure articulates with the vertebral column O mandibular condyle O…

A: The skull is the bony, hello, round shaped structure of axial skeleton system, that protects our…

Q: Define and describe hypertrophy of skeletal muscles. Whatconditions stimulate it?

A: Hypertrophy is described as a condition where there is an increase in the skeletal muscles. This…

Q: If your footprint is greater than 1.72 hectares, outline a plan to reduce your footprint.

A: Ecological Footprint: A person's or a community's environmental footprint, measured in terms of the…

Q: Describe the expression pattern of the Drosophila geneeve in the early embryo.

A: Drosophila development involves the specification of early embryonic cells by various cytoplasmic…

Q: Compare and contrast diffusion and convection. In what way dothey “alternate” in the O2 transport…

A: Introduction Diffusion is defined as the net movement of something from a higher to a lower…

Q: What are taxonomic aids? Mention some of the taxonomic aids for identification.

A: Taxonomy is the science of naming, describing, classifying organisms. The father of Taxonomy is Carl…

Q: Choose the correct answer: A) When the voltage gated K+ channels open K+ moves down its…

A: Let us discuss each option separately to figure out the correct option out of all. Whenever voltage…

Q: Why is the epithelial tissue characterized as polar sheets? answer and explain

A: INTRODUCTION Tissues are the groups of cells that perform a particular or similar function in the…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Introduction : 4 alleles control coat colour of guinea pig Black = B Sepia = S Cream = C Albino…

Q: Explain how and why the Queen bee abort the sexual maturation of the worker bees?

A: * Honey bee Colony consists of three types of Bees A single queen Hundreds of male drones…

Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…

A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…

Q: ANIMAL PHYLOGENETIC TREE - (3) mammals avians squamates lungfish ray-finned fish

Q: In bacteria, Which of the following mechanisms is the least probable in promoting antibiotic…

A: Antibiotic resistance Antibiotic resistance bacteria are those which are able to survive in…

Q: Type of Dermal Scale Cosmoid Placoid Shark Tooth Ganoid Cycloid Ctenoid Mammalian Tooth To compare…

A: Introduction cosmoid scales have hard enamel, inner layer of cosmine , and vascular bone layer.…

Q: explain the processes that occur during the act of defecation

A: Defecation is the final act of digestion, by which organisms eliminate solid, semisolid, or liquid…

Q: What is an ecological footprint? Explain what is meantby the term overshoot.

A: An ecosystem is usually defined as the way they are sated as the community of living organisms that…

Q: Complete the formula for the Krebs Cycle: glucose (sugar) + carbon dioxide anergy C8 ATP)

A: In case of aerobic respiration, single molecule of glucose results in the production of 38 molecules…

Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…

A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…

Q: 'Gamma-delta' T cells differ from 'alpha-beta' T cells by all of the following except O alpha-beta…

A: 'Gamma-delta' T cells differ from 'alpha-beta' T cells by all of the following except A. alpha-beta…

Q: - research and explain about the genetic drift -differentiate founder effect from bottleneck…

A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…

Q: The increase in air CO2 concentration leads to global warming and extreme weather. What are the…

A: C4 species, the photosynthesis is nearly saturated under recent ambient [CO2] von Caemmerer, It has…

Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…

A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…

Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…

A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…

Q: how much nuclear DNA in picograms is present in a skin cell during anaphase?

A: DNA is the genetic material present indide the nucleus of each of the cells in the eukaryotic body.…

Q: 6. Which of the following structures are regulated by autonomic nervous system? A. Epidermis, heart…

A: Autonomic nervous system is a component of peripheral nervous system that controls involuantory…

Q: O GCATGCT O ATGCATC O TCGTACG O CTACGTA

A: Maxam-Gilbert sequencing was initially more popular, in the end, Sanger sequencing won thanks to its…

Q: 2. Which is a better mode of reproduction sexual or asexual? Why?

Q: Explain "Numerical taxonomy" briefly.

A: Introduction In this question we will explain the Numerical taxonomy.

Q: List some applications of DNA fingerprinting.

A: The DNA of every human on the planets is 99.9% the same. However 0.1 percentage of the DNA is unique…

Q: why is polyspermy lethal in an egg cell?

A: Polyspermy is defined as the introduction of two or more sperm cells into the cytoplasm of an egg.

Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…

A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…

Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…

A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…

Q: Compare and contrast electrical and chemical synapses.

A: When two chromosome joins they form synapsis during the cell division process and it is done between…

Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: 9) Choose the best answer. Identify the two types of anaerobic respiration.

A: Anaerobic respiration is defined as a biochemical process of respiration not involving oxygen.'…

Concept explainers

Conservation Biology

The study of how to prevent the loss of biological diversity on the planet is called conservation. Biological diversity, also termed biodiversity, consists of various life forms found in a specific location or across the entire planet, including ecosystems, species, populations, and genes. Conservation thus aims to protect the diversity of life at all levels of biological organization.

Question

What possible solutions can be used to address the problem of freshwater crocodiles became endangered?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How could the public health system approach the problem of water scarcity in the United States?
Will a fish replaced from a freshwater source to an aquarium with sea water be able to survive?Give reasons,
Below is a graph on the fate of bifenthrin within the aquatic environment with various sediments. i. State a hypothesis
This is a question NOT a writing assignment Summarize the case of the Atlantic cod. In your response, specifically address the following points: What method is most commonly used to extract cod? What are the environmental consequences of this method? What is the evidence that cod are being overfished? What remedies have governments enacted to help restore cod populations?
What changes to the rules for Dinotefuran use were made by ODA to limit future bee kill incidents and were they appropriate?
Which of these describes a possible solution to protect South Carolina residents from the effects of harmful algal blooms? A) plans and supplies to prepare for emergency evacuations B) warnings to switch to store bottled water instead of tap water C) laws prohibiting the building of new development close to shores D) advisories concerning which fish and other seafood to avoid eating
As a global citizen, how can you save the life below water?(cite a references)
Solve this reconstitution medication
What can you infer from the fact that minor changes in water temperature can kill entire species?A. Many species are not well-suited to their natural habitats. B. Many species are extremely sensitive to changes in their environments. C. Many species have extremely weak immune systems. D. Many species that live in water once lived on land.
In the Orca/sea otter/sea urchin/kelp system mentioned in another question, which species would be most affected by a spill of mercury or other fat soluble toxin into the ecosystem? Group of answer choices a. sea urchin b. kelp c. orca d. sea otter
In not more than 200 words or 5 sentences, explain why or why not shark finning used in shark fin soup can induce the destruction of the coral reef ecosystem.
Based on the information provided from the report of the West Virginia Chemical Spill and The Human Impact on the Natural Environment, what are the effects humans can have on bodies of water?