What type of mass spectrometer can determine the structure and molecular weight of a compound like quercetin? Explain the principle behind this MS.
Q: Can we determine the type of monosaccharide with the Molisch experiment?
A: Carbohydrates have the chemical formula Cn(H2O)n and are organic molecules. This formula, however,…
Q: Dihedral angles of Phe165 of 4KW4 betasheet values are consistent with what is expected from the…
A: phi and psi angles are known as dihedral angles. They dictate the peptide conformation. phi…
Q: The protein concentration of a known standard is 100mg/mL If you prepared a serial dilution, mixing…
A: The process of reducing the concentration of a solution by adding more solvent is known as dilution.…
Q: A biochemist discovers and purifies a new enzyme, generating the purification table below. Procedure…
A: Specific activity of an enzyme can be calculated by dividing the number of unit by its concentration…
Q: Draw a structure for the compound, C3H5Br, that fits the following 1H NMR data: δ 2.32 (3H, singlet)…
A: Nuclear magnetic resonance Spectrum represents the different interactions of stereochemically…
Q: What are some examples of biochemical tests for proteins that involve acid hydrolysis or base…
A: Proteins: Proteins are complex high-molecular-weight molecules that consist of amino acids joined…
Q: What reagents promote cross-linking between acrylamide and bisacrylamide to form polyacrylamide gel?
A: Polyacrylamide gels are used for the separation of biomolecules. The polyacrylamide gels are…
Q: Based on the structure of lipids triacylglycerol, phospholipid, and cholesterol, why are they easily…
A: Introduction Triacylglycerols are triesters of fatty acids and glycerol. These are composed of three…
Q: Which organic molecules may be found in urine from a patient with kidney illness, and which…
A: Kidney disease refers to when the kidneys aren't working properly and can't filter the blood.…
Q: 75 mL of 0.2 M NaOH were added to 100 mL of 0.1M aspartate solution, pH=pl. What is the new pH? pKa…
A: The titration of the amino acid with a strong base like NaOH results in the loss of protons in a…
Q: Beyond the differences in molecular mass, what is different about determining the molarity of a…
A: Concentration of the solution is also expressed in terms of molarity. Molarity refers to the number…
Q: Can you please do number 1 and show the steps
A: The metric system is an internationally recognised decimalised system of measurement. It is in…
Q: Suggest the qualitative test for the compound with molecular formula CeH;Br;0. Predict what…
A: Spectroscopy is defined as the technique of splitting light (electromagnetic radiation) into its…
Q: What is the net average charge on the predominant form of lysine at pH values of (a) 2.0, (b) 5.0…
A: Amino acids are organic compounds having carboxyl group and amino group. At extreme low pH, amino…
Q: Potentiometric titration curve is given below, which is obtained during the potentiometric titration…
A: Asked : Question related to the shown titration curve x,y represent Volume of KOH, pH of solution…
Q: What is the melting temperature and G/C content of the following primers? a.) 5’…
A: A primer is a short single strand of DNA that serves as a starting point for DNA synthesis of a new…
Q: Which of the following is not a nitrogenous base? Group of answer choices A. guanine B. uracil C.…
A: Nucleic acids act as templates from which all proteins are made. They are long, chain-like molecules…
Q: Estimate the molecular weight of a B-a-B supersecondary element that is 3 nm high?
A: Supersecondary structures (also called motifs ) are characteristics folds in proteins composed of 2…
Q: What is the importance of redox couple in metalloproteins, explain using. an example
A: Introduction: A redox couple contains both the oxidized and reduced form of a compound that is…
Q: IUPAC name for the structure given. (DO NOT write "cis or trans") * H
A: Since this is a structure having a -COOH functional group and rest all is a CH backbone thus it…
Q: Why do trioses and tetroses give negative result for the Molisch’s Test? Explain with the help of…
A:
Q: Can the iodine test distinguish between amylose and amylopectin? What would you look for?
A: Carbohydrates are an essential source of energy. It is found in almost all foods and is largely used…
Q: A compound with empirical formula C2H5O was found in a separate experiment to have a molar mass of…
A: Molecular formula gives the kind and number of atoms of each element present in the molecule of the…
Q: Provide a brief definition and a description of the significance of the following terms in NMR…
A: Introduction: The utilization of the NMR method to consider the physical, chemical, and natural…
Q: Refer to the following titration curve below: 13 12 11 10 7 6 5 4 4 6 8 10 12 14 16 18 20 22 24 26…
A: Iso electric point: the pH at which the Amino acid exists in a zwitter ionic state us called iso…
Q: Classify the following nitrogenous bases into purines or pyrimidines.
A: Purines : Adenine and Guanine are purines . Pyrimidines : Thymine , Cytosine and Uracil are…
Q: Comment on why the feature ~210 nm in Circular Dichroism and Infrared spectroscopy is useful for…
A: Circular dichroism spectroscopy (CD) is a fundamental insightful method used to investigate…
Q: In solubility test, why do we need to put the lipid samples in a direct heat after adding ethanol?
A: In solubility test, why do we need to put the lipid samples in a direct heat after adding ethanol?…
Q: What is the approximate net charge of carnosine at pH 5.
A: Carnosine, also known as beta-alanyl-L-histidine, is a dipeptide . It is made up of the amino acids…
Q: Calculate the Redlich-Kwong parameters of fluorine from the values of the critical constants
A: a = R2Tc5/29Pc(21/3-1) For , fluorine…
Q: You assay 0.5 ml of 1/2000 diluted egg white for protein, as described in the practical schedule,…
A: Standard calibration curves are plotted by taking concentration of the solution in x axis and…
Q: Why Ranitidine is better than Cimetidine ?
A: Drug therapy aids in the treatment of various medical conditions by the administration of a drug…
Q: TE buffer consists of 10 mM of Tris-Cl, pH 7.6 and 1mM of EDTA, pH 8.0. You need to prepare 3L of TE…
A: Given Values: The concentration of the stock solution of Tris-Cl = 500 mM The concentration of the…
Q: What is the energy of the X-ray photon emitted by a tungsten atom in the transition from an L- shell…
A: The K, L and M shell electron binding energies of Tungsten are as follows K shell binding energy =…
Q: You are asked to make a 5M solution of SO 2, how many grams do you need?
A: A solution is a homogenous mixture that is homogenous. It is made up of two substances or more…
Q: What will be the size of the larger product? O 5254 bp O 5192 bp O 5231 bp
A: Base Pairs -- Base pairs describes the relationship between the building blocks on the strands of…
Q: Biologically and nutritionally importanttrace elements tend to be metals. What is their likely…
A: Trace metals are a form of trace elements that are present in very low concentrations or amounts (in…
Q: Does the suggestion as to why methotrexate has such a high affinity CHANGE when told that…
A: Methotrexate binds to protein with opposite orientation to folate. Methotrexate inhibit enzymes…
Q: You need to nake 100mL of a 0.2 molar sucrose (C12H22O11) solution. How much sugar do you need to…
A: Molarity in simple terms can be defined as the amount of any substance present in a certain volume…
Q: What are the applications of the Henderson Hasselbalch equation in pharmaceutical analysis? use your…
A: Henderson Hasselbalch equation is a mathematical expression that relates or links the pH of a…
Q: Can Gas Chromatography-Mass Spectrometry (GC-MS) determine the structure and concentration of…
A: GC-MS is a method that combines the features of gas chromatography and mass spectrometry. This…
Q: WHAT ARE THE ADVANTAGES AND DISADVANTAGES OF CARBOHYDRATES IN BIOCHEMISTRY? GIVE AT LEAST 3 FOR EACH…
A: Carbohydrates are the one of the biomolecules that provide energy to the human body. They are mainly…
Q: What quality of zwitterions makes them desirable buffers?
A: A buffer is a solution that can withstand pH changes when acidic or basic components are added. It…
Q: . Explain in detail the Shine-Dalgarno sequence.
A: A ribosomal binding site (RBS) is a nucleotide sequence upstream of an mRNA transcript's start codon…
What type of mass spectrometer can determine the structure and molecular weight of a compound like quercetin? Explain the principle behind this MS.
Step by step
Solved in 2 steps
- Can Gas Chromatography-Mass Spectrometry (GC-MS) determine the structure and concentration of quercetin? Why? What about Liquid Chromatography-Mass Spectrometry (LC-MS)?Can we determine the type of monosaccharide with the Molisch experiment?Propanamide and methyl acetate have about the same molar mass, both are quite soluble in water, and yet the boiling point of propanamide is 486 K, whereas that of methyl acetate is 330 K. Explain.
- If the average molar mass of a sample of soybean oil is 1500 g/mol, how many grams of NaOH are needed to saponify 5.0 g of the oil?What will happen when Ranitidine is expose in sunlight/ moisture? What molecular changes is form when Ranitidine is expose in sunlight/ moisture? Please explain at your own words .In solubility test, why do we need to put the lipid samples in a direct heat after adding ethanol?
- Provide a brief definition and a description of the significance of the following terms in NMR spectroscopy (4) a 90o pulse(5) J coupling(6) distance geometryExplain how you would prepare 100ml of 10mMProline solution given that the molecular mass of proline= 115.13 g/molA compound with empirical formula C2H5O was found in a separate experiment to have a molar mass of approximately 90 g. What is the molecular formula of the compound?
- Which organic molecules may be found in urine from a patient with kidney illness, and which biochemical test would be the most suited for detecting those molecues?What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’Based on the structure of lipids triacylglycerol, phospholipid, and cholesterol, why are they easily isolated using non-polar solvents?