What type of spontaneous change to DNA is caused by UV light? deamination
Q: RNA Pol III transcribes the following class of RNAS TRNAS rRNAs small nuclear RNAS All of the above
A: RNA pol III :- eukaryotic RNA polymerase, help in eukaryotic transcription.
Q: How does NanoDrop quantify DNA?
A: Quantitative analysis techniques are used to measure the quantity of a substance in a solution.…
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: In bullet form, what are the salient features and functions of steriods? Salient features of…
A: Steroids are biologically active compounds. Steroids are found in plants, animals and fungi.…
Q: Using punnet square, determine the chances of an autosomal recessive trait produced from the cross…
A: The Punnett square is used for the determination of genotype. Punnett square is a square diagram in…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: Significance of proteins in CSF and how to determine the cerebrospinal fluid analysis protein.
A: Protein, like the enzymes, blood, and cerebrospinal fluid, may be found in practically all human…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: A homozygous individual has what allele(s) of a particular gene? Select one: a. 2 dominant or 2…
A: An allele is described as an alternative form or version of a gene. An individual inherits two…
Q: D Question 5 5. Comparisons of homologous proteins can provide information about how important an…
A: Homologous protein are the protein that is the proponent of the ancestors of both human and dog.…
Q: Question #1: Please describe the specific enzymes that you are familiar with that are involved in…
A: " Since you have asked a multiple question , we will solve the first question for you. If you want…
Q: What is the composition of minimal initiation complex during transcription? TBP, TAF, TFIIA, TFIIB,…
A: In eukaryotes several transcription factors are necessary for the basal expression of an eukaryotic…
Q: hat are the components of Water? Explain and show some illustration
A: Introduction: For the existence of all living things, water is very essential. Without water, one…
Q: the structure of a soap molecule, use the concept of intermolecular forces to explain why we use…
A: Soap molecules has hydrophilic head and a hydrophobic tail, they are composed of long chains of…
Q: Which histone is present in a chromatosome? H1 H2A O H3
A: Chromatin is a macromolecular structure in eukaryotic cells that is mostly made up of DNA and…
Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…
A: The activity of many proteins are modulated by post-translational modification of the proteins.
Q: Why is it agreeable from a food safety point of view to keep soy sauce in your cupboard and not the…
A: Soy sauce is produced by the fermentation of soyabeans, grains, and brine using molds- Aspergillus…
Q: Patient who had undergone a complex maxillofacial operation could not take food during 2 days, but…
A: Introduction: The level of blood glucose monitoring gives us insight into the effectiveness of the…
Q: c. Ribulose 5-phosphate levels would decrease. d. NADH to NAD+ ratios would decrease. e.…
A: In the RBC's of the patients certain changes are observed. Ribulose 5 Phosphate levels would…
Q: Succinyl-CoA Synthetase mechanism Succinyl-CoA synthetase enzyme active site O Substrates bind to…
A: Succinyl-CoA-Synthetase: This is an enzyme of TCA cycle catalyze the conversion of Succinyl-CoA to…
Q: Which of the following are responsible for removing introns from RNAS in eukaryotes? Major…
A: RNA splicing : It removes the interrupting, non-coding sequences of the genes (introns) from…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Steps in Prokaryotic Translation Initiation: GTP bond Initiation factors (IF1-3) binds to 30S…
Q: Enzymes occasionally display weak "side" activities. Draw the structure of the product (other than…
A: Pyruvate is formed in the last step of glycolysis with release of one ATP per molecule, catalyzed by…
Q: te the structure for a generic triacylglyceride at pH 7.4.
A: ''Since you have asked multiple question , we will solve the first question for you . If you want…
Q: Consider the typical beta oxidation of linoleic acid (C18:2 ^Δ9, 12): How many ATP are generated in…
A: 117 ATP
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: 4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D.…
A: Introduction: Corticosteroids are steroid hormones that are synthesized in the adrenal cortex. It is…
Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA
A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…
A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…
Q: gel electrophoresis
A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…
Q: Determine whether the following monosaccharides have D or L configuration and classify them based on…
A: In the d/l system (named after Latin dexter and laevus) molecules are named relating them to the…
Q: Loss of function mutation results in a _ allele.
A: Mutations are sudden changes in the gene sequence. When these changes causes loss of function of an…
Q: 3. Do enzymes act better under acidic or alkaline pHs?
A: Most favored pH value - the pH point where the enzyme has most activity - is known as the optimum…
Q: Which biomolecules contain nitrogen?
A: The four classes of biological macromolecules are: nucleic acids, proteins, lipids and…
Q: 5. Use this figure to summarize how the ATP is used as energy "currency", harnessing some of the…
A: ATP is used as a energy currency due to the presence of two high energy phosphoanhydride bonds…
Q: Using specific examples of receptor-ligand binding, compare and contrast cell signalling by G…
A: Receptors are proteins, which bind to a specific ligand and triggers signaling pathways inside the…
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: 5- Draw structure of products in the following metabolic reactions and name the enzyr involved and…
A: Introduction: The drug metabolism is needed to convert non-polar lipophilic compounds into polar…
Q: How many number of histone proteins present in a nucleosome? 4 6 9.
A: The nucleosome is the basic structural unit of DNA packaging in eukaryotes and represents a segment…
Q: In the case of autosomal recessive mutations, the frequency of the disease in a population is…
A: Autosomal recessive inheritance It is a particular way of genetic trait or condition which can be…
Q: 7. The standard free-energy change (in terms of net ATP production) when glucose is converted to 6…
A: All living organism except extremophiles metabolize carbohydrate particularly Glucose to meet up the…
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…
A: The TCA cycle or tricarboxylic acid cycle is the second stage of cellular respiration. This is a…
Q: The following structure is D-sorbose. Which reagent will oxidize D-sorbose? CH2OH C = 0 Н-С-ОН НО -С…
A: Sorbose is a ketose belonging to the group of monosaccharides
Q: Consider the following peptide sequence: His-Pro-Lys-Arg-Ala-Gln-Ser-Cys-Pro Which test will the…
A: Proteins are polymers of amino acids in which the amino acids are linked together by peptide…
Q: Why most of the clinical features of the diseases Krebs Cycle inborn errors ( a- ketoglutarate…
A: Krebs cycle : This pathway plays an important role in the living cell metabolism also known as…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…
A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…
Q: Explain what Hepatocyte hopping is
A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…
Step by step
Solved in 2 steps
- Large DNA damage is primarily recognized by: Question 21 options: changes to tertiary structure of DNA scanning regions of euchromatin changes in primary structure of DNA changes in secondary structure in DNA scanning each individual nucleotide in the DNA moleculeWhich of the following is involved in the repair of cyclobutane pyrimidine dimers? DNA pol I DNA ligase reverse transcriptase a photolyaseWhich of the following enzymes has a major role in joining of DNA fragments (Okasaki fragments) during DNA replication? Group of answer choices DNA gyrase Helicase Primase DNA polymerase DNA ligase
- Which enzyme can recognize an altered base in the DNA? Group of answer choices DNA Polymerase AP endonuclease Helicase DNA glycosylasesWhat enzyme breaks the H-bond between nucleotides of DNA? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase IIIWhich type of DNA variant is most likely to result from slippage of DNA polymerase during replication? simple sequence repeat (SSR) single nucleotide polymorphism (SNP) insertion or deletion (InDel) copy number variant (CNV)
- AZT (3'-azido-2',3'-dideoxythymidine) is a drug for HIV infection that gets incorporated into growing viral DNA and blocks the activity of: reverse transcriptase Integrase DNA ligase DNA polymerase β (beta).Which of the following DNA repair mechanisms involves the 3’ to 5’ exonuclease function of DNA polymerase? postreplication repair mismatch repair SOS response DNA proofreading base excision repairWhich enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction? Group of answer choices DNA ligase primase DNA polymerase I DNA polymerase III
- Which of the following DNA repair systems requires an involvement of the RecA protein? Mark all the correct answers Mismatch repair SOS response Photoreactivation repair DNA proofreading Postreplication repairWhich of the following DNA Repair systems is most likely to be activated after someone goes to a tanning booth? Base Excision Repair Nucleotide Excision Repair Double Strand Break Repair ProofreadingAll of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr A C. Uvr C D. Ligase E. Gyrase