Question #1: Please describe the specific enzymes that you are familiar with that are involved in the catabolizing of carbohydrates, lipids, protein, and nucleic acids. At what pH are these optimized?
Q: Question 10 Hormones, such as testosterone, estradiol and progesterone are examples of steroidal…
A: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. True OR…
Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…
A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…
Q: Gluconeogenesis in the liver is When blood glucose levels are low, glucagon is secreted from the…
A: Blood is defined as the type of constant circulating fluid that play a major role in carrying…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: The Molisch's test, Fehling's test, and Bial's test are the qualitative tests for carbohydrates. In…
Q: Which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their structure?…
A: FAD/FADH2, NAD+/NADH, and NADP+/NADPH are cellular electron carriers and ATP is the energy currency…
Q: Describe the basic chemical requirements for the aminoglycosides. Why are these compounds strongly…
A: A base can accept the protons from the solution and can exist as a cation. An acid can donate its…
Q: You receive a tube containing 18.8 nmol of lyophilized (freeze dried) primers to be used in PCR. How…
A: Primers are a short nucleic acid sequence that provides a starting point for DNA synthesis. I…
Q: please name and characterize the enzym class according to the given rraction C=O 0. CH ČH-OH C=O Ó.…
A: The given molecule is fructose-1,6-bisphosphate which is broken down to glyceraldehyde-3-phosphate…
Q: Question 5 In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B A.
A: Cell membrane is made up of lipid bilayer. The composition of different types of lipids has very…
Q: Which pair of bases is linked together by two hydrogen bonds? Group of answer choices guanine and…
A: Purines pairs with pyrimidines via formation of H-bonds. Purine: Adenine, Guanine Pyrimidine:…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: In the structure of vancomycin, what moiety contributes to its solubility in polar medium?
A: Vancomycin is a glycopeptide antibiotic and kills gram-positive bacteria such as…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: 4. During a lunch at a MeDonald's outlet, an office employee received about 350 g of carbohydrates…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. Coenzyme b.…
A: The non-protein factors that are necessary for activity of some enzymes are called cofactors.
Q: All are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b.…
A: The components of the Electron Transport Chain (ETC) are found in the mitochondria. During…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: 6. Describe the salient features and functions of phospholipids
A: Phospholipids or phosphatides are molecules which belong to the class of lipids has hydrophilic…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: 2. Biosynthesis of thyroid hormones. Proteins: A. Thyroglobulin with DIT. B. Thyroglobulin with T C.…
A: As shown in the given figure, thyroid hormone synthesis occurs in following steps: iodide (I-)…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate of the…
A: The hexose monophosphate shunt, also known as the pentose phosphate pathway, is a shunt from…
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: Visceral fat loss is often associated with increased insulin sensitivity. Assuming that with the…
A: D. -10.6
Q: Which pathway uses glucose 6-phosphate to produce NADPH, ribose 5-phosphate, and other sugar…
A: Major metabolic pathways of carbohydrates are glycolysis, TCA cycle, gluconeogenesis, glycogenesis,…
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: The solubility of a protein in solution depends on nature of the protein and the concentration of…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: Mutations in enzymes of the metabolic pathways are called inborn errors in metabolism.
Q: What is the heterozygous advantage of people having sickle-cell trait in areas where malaria is a…
A: Introduction: Sickle cell anemia is an autosomal inherited blood disorder that affects hemoglobin…
Q: Three sugars (Sugar A, Band C) were applied to a line as part of the set-up of a Paper…
A: Paper chromatography is the basic technique to separate dissolved chemical substances from the…
Q: POST-LAB QUESTIONS 1. When a reducing sugar reacts with Benedict reagent, what organic product is…
A: 1. The Benedicts reaction with reducing sugar is given below. Reducing sugars can be either in…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…
A: Bioremediation is a waste management technique. Living organisms can be used in this process to…
Q: In which of the following processes is glucose 6-phosphate the end product? Group of answer…
A: Glucose : Carbohydrate that serves as the major energy source for the body. Glucose-6-phosphate:…
Q: The polypeptide chains in insulin are held together by hydrogen bonds Group of answer choices True…
A: Insulin is a protein made up of two polypeptide chains designated as A (21 amino acids residues) and…
Q: True or False? a. An excess of amino acids can result to the destruction of proteins.
A: The destruction of proteins in cells can occur when due to misfolding and aggregation of proteins…
Q: HN- CH- OH HN-CH-c- -OH HN-CH-C-OH CH CH2 CH2 CH2 OH C= NH2 OH A B D C.
A: Amino acids are those molecules which combine to form particular proteins. Amino acids and proteins…
Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…
A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…
Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…
A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…
Q: Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA…
A: mRNA is the product of transcription formed from DNA by RNA polymerase. This mRNA is important for…
Q: Introduction to urinary proteins and CSF proteins.
A: Protein is a highly complex molecule found in all living things. Proteins were identified as…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: What enzyme is the point of regulation for fatty acid synthesis in the cytoplasm? Fatty acid…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: i need the answer quickly
A: Vitamin B6 aids in the maintenance of a healthy level of this amino acid in the blood. A more…
Step by step
Solved in 3 steps
- Question 1) Imagine you’re making a yeast from scratch, and you’re worried your yeast may sometimes not have access to the amino acid methionine. You decide to put some genes in that code for proteins that allow it to make methionine, just in case your yeast happens upon circumstances where it can’t eat methionine. It seems wasteful to produce these proteins all the time though. Why? Question 2) In order to not waste a bunch of energy and materials making proteins to make methionine when the yeast doesn’t need to make methionine. You organize the DNA so that the genes are controlled by a promoter. Which promoter makes sense and why? i) lac promoter, turns on when lactose is present. ii) Pmet3 promoter, turns off when methionine is present. iii) pbr promoter, turns on when lead is present.What major theme in biology do substrate-enzyme interactions fit under? Choose the BEST answer. Choice 1 of 5: Evolution Choice 2 of 5: Flow of information Choice 3 of 5: Structure and function Choice 4 of 5:Transformations of energy and matter Choice 5 of 5: Interactions between systemsWhich of the following was the least likely objective of the Urey-Miller experiment? Group of answer choices To demonstrate that oxygen can be produced by plants. To recreate the conditions of the Earth before life existed and produce the molecules necessary for life from primordial inorganic matter (water, methane, ammonia, and carbon dioxide). To build a case (though not necessarily prove) that life can originate from nonliving matter through natural means. To demonstrate that organic molecules like amino acids (building blocks of protein) and nucleotide bases (building blocks of DNA) do not necessarily originate only from living matter. To demonstrate that lightning may have been the essential energy source (early in Earth's evolution) in the production of molecules essential for life.
- Which of the following questions about the origin of life on Earth is most scientifically testable? * Why were the earliest life-forms created using only twenty amino acids? Did life originate to make the universe a better place? Was catalytic RNA used by ancient organisms as a stepping stone to acquire protein enzymes? Can simple organic molecules form spontaneously in an oxygen-free atmosphere?The purpose of this experiment is to determine how the activity of an enzyme can change under certain conditions: temperature, pH, substrate concentration Introduction Purpose statement is specific, complete and uses proper scientific vocabulary Hypothesis statement is clear, logical and scientifically sound Contains sufficient background information relevant to the lab Accurate use of examples and scientific terminology Clear, concise (max 1 page; single spaced) Step 1: Obtain a sample amount of a hard fruit or vegetable, such as an apple, cut it into smaller equal pieces, and measure on a digital scale of 10g. Step 2: Get 100ml of room temperature tap water and add it into a glass cup, heat it on a hot plate until reaches 37 Celsius Step 3: Add the apple sample into the glass cup with the tap water and mix gently. Let the mixture to sit for 5 minutes. Step 4: With a kitchen thermometer measure the temperature of the apple mixture. Step 5: In a glass cup add 3mL of 3% hydrogen…Why are possible sources of biologically available energy in theterrestrial subsurface?
- The One Gene One Enzyme Hypothesis (Beadle and Tatum, 1941) stated that each gene codes for a single enzyme. Summarize the advancements that have made the One Gene One Enzyme Hypothesis obsolete.Enzymes are proteins, and therefore are structurally linked to DNA sequences. How could natural selection alter the metabolism of an organism?Which of the following is least reasonable regarding the Urey-Miller experiment? Group of answer choices The experiment was an important breakthrough in the study of the origin of life. The experiment conifirmed that several of the key molecules of life could have been synthesised naturally on the primitive Earth. The amino acids and other molecules produced in the experiment, and possibly present in the early atmosphere, could have participated in 'prebiotic' chemical processes, ultimately creating life. This experiment, and others which followed, suggests that simple biologically significant molecules can evolve naturally under sets of conditions that may have existed not only on early Earth, but potentially elsewhere in the solar system and beyond. The experiment was the first demonstration of abiogenesis (life from non-life).
- Simple systems (of this type) of RNA , enzymes, and coenzymes have been created in the laboratory. Which probable stage of physical and chemical evolution of life is that.Explain the process that is depicted by the diagram below. (What is the overall purpose of the process?What kind of organism uses this process? What is the overall significance of this process to life? *please answer the question being asked. answer should be short and conciseQuestion: A. What were the organic monomers that were created in the first step of chemical evolution and what are there organic polymers? B. How are the current changes in the ecosystem impact the evolution of organisms in the environment?