Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…
A: Bioremediation is a waste management technique. Living organisms can be used in this process to…
Q: The 6-member pyranose ring of glucose is formed through the interaction of the hydroxyl group on C5…
A: The carbohydrate glucose can form an intramolecular cyclic hemiacetal.
Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…
A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…
Q: Feedback See Periodic Table Which of the following correctly describe both a lectin and a…
A: Lectins are stated as either the proteins or the glycoproteins that are present in almost all…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…
A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…
Q: (osgnthesis
A: Retrosynthesis is a breaking down of targeting molecule by the process of ''breaking down '' a…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris
A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…
Q: Answer the following multiple-choice questions and EXPLAIN in 3-5 sentences why you chose that…
A: Enzyme is basically biocatalyst that increase the rate of chemical reaction without itself being…
Q: How would you develop an assay for soybean trypsin inhibitor and use it to test products??
A: Trypsin inhibitor: Also known as serine protease inhibitor i.e serpins inhibitors control the…
Q: Write about the treatment of Complicated and uncomplicated Urinary tract infection? Please answer…
A: A urinary tract infection (UTI) is a frequent form of infection that affects the urinary tract. Any…
Q: Enzymes accelerate the rate of a reaction by: a. lowering the number of molecules with lower…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: SMC proteins participate in DNA bending that contributes to folding and condensation. True False
A: SMC is expanded as Structural Maintenance of Chromosomes. SMC complexes are the ones that represent…
Q: residues listed below: (a) Ser195 (b) His57 (c) NH groups of Gly193 and Ser195
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: What are other staining methods that can be used for PAGE?
A: Introduction: PAGE electrophoresis is a subtype of gel electrophoresis whereby normal gel is…
Q: mg/L of cell tissue and 10 mg/L of ammonia
A: TKN is refers to the term Total Kjeldahl Nitrogen which is defined as the total concentration of…
Q: 4. Read the absorbance at 595nm of the blank and test solutions. Calculate the protein concentration…
A: Bradford method of protein assay: This is a method used for determination of concentration of…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: The initiation stage in translation starts with the binding of some initiation factors with the…
Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: HomeExpert Q&AMy answers How is serine related to the activated methyl cycle? Serine’s side chain…
A: Serine is a non-essential amino acid. It is a glucogenic amino acid. Serine undergoes deamination…
Q: 1. List several methods (other than Bleeding Time -Ivy method, Capillary Tube Method, Lee and White…
A: Introduction: Bleeding time: It is the time interval between the skin puncture and spontaneous,…
Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…
A: Chromatography is an analytical technique for separating components of a mixture
Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…
A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: At which position(s) are amino acids limited to those Which amino acid(s) are more commonly found at…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: A protein sample of unknown concentration was placed in a cuvette with a path length of 1 cm and the…
A: The concentration of a protein is directly proportional to the amount of light it absorbs. The…
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: Describe the process of DNA replication, including the enzymes involved (85%), and give two examples…
A: DNA replication is a process of duplication of genetic material during the process of cell division…
Q: e. 92 sister chromatids
A: In eukaryotes, two types of cell division partition the genetic material into progeny or daughter…
Q: CH,0-P-O C=o 0. CH;0-P-O CH,OH C=O Ó. HO-C-H H-C-OH H-C-OHO C-H ČH;O-P-O- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the process in which glucose is broken down to produce two molecules of pyruvate, ATP,…
Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…
A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…
Q: What's the length of the DNA around histone core in a nucleosome? 50 base pairs 146 base pairs 8…
A: Nucleosome:- Histones are responsible for the first level of DNA packing and most basic level of…
Q: Explain the mechanism of Warburg effect and how it benefits cancer cells
A: Cancer means uncontrolled cell growth. This uncontrolled cell growth may cause a lump of cell or…
Q: 3. Draw the chemical structure of cholesterol and state its functions 4. Explain in detail the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 1- phenyl hydrazine +Fructose 2-Galactose + Br; /H,O ?
A: Compounds containing the -CO-CHOH group form osazones with phenyl hydrazine.
Q: What is the purpose of acrylamide and bis-acrylamide? in SDS-Page Gel
A: Sodium dodecyl sulphate-Polyacrylamide gel electrophoresis (SDS-PAGE) is a common analytical…
Q: A solution has a pH of 5.4. What is its pOH O5.4 8.6
A: The hydrogen ion concentration [H+] and hydroxide concentration [OH–] in a aqueous solution have an…
Q: Proteomic analysis by mass spectrometry involves digestion of samples with to generate peptide…
A: Tandem mass spectrometry is a major technique for the peptide/protein sequencing and PTM analysis.
Q: the enzyme and substrate should be mixed only when the reaction is initiated (when the absorbance…
A: Kinetics is the branch which deals with rate of changes. From above all given situations in the…
Q: Using specific examples of receptor-ligand binding, compare and contrast cell signalling by G…
A: Receptors are proteins, which bind to a specific ligand and triggers signaling pathways inside the…
Q: 4. During a lunch at a MeDonald's outlet, an office employee received about 350 g of carbohydrates…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: 8. Which of these is not an example for stereo specificity? a) L-lactate dehydrogenase will act only…
A: Many enzymes can discriminate between enantiomeric substrates and such enzymes exhibit…
Q: . Using electron flow arrows, show electron transfer from nadh to fmn in complex 1 of the electron…
A: The electron transport (ETC) chain is coupled with ATP synthesis. ETC occurs in Cristea…
Q: Consider the analogy of the jiggling box containing coins that was described on page 85. The…
A: When we face a situation where rate of forward reaction is euqal to the rate of backward reaction…
Q: Determine the vitamin content of the following fruits and vegetables using…
A: Introduction: Vitamins are organic compounds present in food that are needed in minimal amounts for…
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: In the structure of vancomycin, what moiety contributes to its solubility in polar medium?
A: Vancomycin is a glycopeptide antibiotic and kills gram-positive bacteria such as…
Q: 4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D.…
A: Introduction: Corticosteroids are steroid hormones that are synthesized in the adrenal cortex. It is…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- What is known as polyadenylation signal sequence ?The nucleoside consists of a D-deoxyribose and a cytosine base is called ______. A. cytidineB. deoxycytidineC. deoxycytidylateD. deoxyribosylcytosine E. deoxyribosylcytidineWhich of the following anticodons could be charged with Asparagine (Asn)?Question 23 options: A) 3' AAU 5' B) 3' UUA 5' C) 3' UUG 5' D) 3' UUI 5' E) all can be charged with Asn except 3' AAU 5'
- Which of the following is a nucleoside monophosphate? GMP Adenosine UTP ADPUDPThe change of one conformation of protein to another is called a. allosteric transversion b. allosteric transition c. allylic transversion d. allylic transitionWhich of the following is the C-terminal amino acid in the polypeptide glycyl-alanyl-leucyl-valyl-glutamine? A. Glycine B. Alanine C. Leucine D. Valine E. Glutamine
- which of the following amino acids can undergo post-translational acetylation? A.n B.s C.k D.mDoes Your PDB code: 3GRS have a quaternary structure? YES OR NO? https://www.rcsb.orgWhich of the following amino acid types is mostly likely to be hydroxylated in a posttranslation modification on a protein (example: collagen)? a.) glycine b.) serine c.) glutamate d.) tyrosine e.) proline
- Define the following terms: a. posttranslational modification b. transpeptidation c. translocation d. termination e. targetingWhich of the following nucleotides is mostly likely to form pyrimidine dimers? a. dATP b. dTTP c. dCTP d. dGTP e. dUTPWrite the anticodons for the following amino acids: a) Met b) Trp c) Ser d) Leu
