What was the purpose of transferring the +DNA and -DNA tubes from ice to hot water bath to ice again? O a. heat shocking cells Ob. makes cells more "competent" Oc makos ceils more permeable to DNA d.all of the above
Q: Bacterial DNA has how many origins of replication? A) 0 B) 1 C) 10 D) depends on the size of…
A: Two identical copies of a DNA molecule are produced by DNA replication. This is important for cell…
Q: How is each new nucleotide added to the growing end of a DNA strand? a. A dehydration…
A: DNA is a polymer of deoxyribonucleoside monophosphates (dNMP) covalentlylinked by…
Q: purpose(s) of DNA extraction
A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…
Q: In gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules…
A: Answer is b.) have different lengths.
Q: Which statement about polymerase chain reaction (PCR) is correct? O The PCR primers are made of RNA…
A: Polymerase Chain Reaction is the in vitro application of the process of DNA replication that is done…
Q: Describe the blender experiments of Hershey and Chaseand what the results revealed about DNA’s…
A: Blender's experiment performed by Hershey-Chase in which they proved that DNA is the replicating…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…
Q: DNA gyrasea. promotes negative supercoiling.b. relaxes positive supercoils.c. cuts DNA strands as…
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: Match the Scientists to their Discoveries v Said A=T and C=G in an organism A. Franklin and Wilkins…
A: Many scientists have worked and given theories or discoveries. The first statement says about the…
Q: Which is the 3' end of this DNA stand? A. B. CH С. O The location marked with the red A. O The…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid). DNA…
Q: If DNA had 2 different bases, a restriction enzyme with a 4-base recognition sequence would cut DNA…
A: The frequency of cutting in a random DNA sequence for a given restriction enzyme is once per every…
Q: DNA contains phosphorus whereas protein does not. Protein contains sulfur whereas DNA does not.…
A: Answer. Alfred Hershey and Martha Chase Alfred Hershey and Martha Chase in the years 1951 and…
Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…
A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…
Q: The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to…
A: DNA extractions is a method to isolate DNA from the nucleus of given cell culture. The four steps of…
Q: Which DNA fragment is e smallest? Negative End #1 12 13 <14 Positive End
A: Answer: AGAROSE GEL ELECTROPHORESIS = This is a technique which we use to separate different…
Q: What was the purpose of the sodium chloride in nucleic acid extraction? CHOOSE ALL ANSWERS THAT…
A: INTRODUCTION Nucleic acid extraction It is the process of isolation, purification and concentration…
Q: listed below, match each to the correct definition. Definition a. Unwinds DNA b. Relieves tension in…
A: All these enzymes help and DNA replication. DNA replication process in which exact similar…
Q: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA…
A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…
Q: A groove in the DNA refers toa. the indentations where the bases are in contact with thesurrounding…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: helicase
A: The unwinding of DNA is a complex process. It is done during the DNA replication. It is done when…
Q: The replication of chromosomes by eukaryotes occurs in a relatively short period of time because ?…
A: The DNA replication is the production of new DNA from the old DNA by the semiconservative manner. In…
Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…
A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…
Q: he purpose of using a washing soap in DNA extraction experiment is to D a. Cut the proteins away…
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell It stores genetic…
Q: In this diagram of a DNA electrophoresis gel, which sample contains the smallest molecules? АВСD в с…
A:
Q: DNA nucleic acids are held together by WEAK hydrogen bonds because...? A It was a mistake when being…
A: DNA is a double helix structure present in the nucleus of the eukaryotes.
Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…
A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…
Q: The statement “DNA replicates by a semiconservative mechanism” means that (a) only one DNA strand is…
A: Introduction DNA replication is a semi-conservative and semi-autonomous process. Semi-autonomous…
Q: Determines the order of the four chemical building blocks - called "bases" - that make up the DNA…
A: A nitrogenous base is a molecule with the chemical characteristics of a base and contains nitrogen.…
Q: ) whet will be will be the Amout o DNA conteing Product if melogk inG,-Phose ? metonir - 30lg DNA
A: Mitosis - equational division (2n => 2n) Meiosis - reductional division (2n => n)
Q: Vho first developed the DNA sequencing approach using dideoxynucleoside triphosphates in DNA…
A: DNA was major topic of discuss in early times for scientists. It's structure and constituents…
Q: Cuble stranded DNA molecule of 50 base pars (100 nucleotides total) contains 15 cytosine bases (C).…
A: DNA is a double stranded helix which is a hereditary material of organisms. It contains 4 nucleotide…
Q: cDNA, a term used in recombinant DNA technology meansa) Competitive DNAb) Chemical DNAc) Complex…
A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms. DNA contains the instructions…
Q: uit L Tepresents part of a DNA molecule. 5' T ATGCTT C CA TACG A AGG TCA 3' 3' G T Figure 2 (c)…
A: The process of replicating a double-stranded DNA molecule into two identical DNA molecules is known…
Q: DNA replication is a semi-conservative process
A: In molecular biology, DNA replication is the process of synthesizing two identical copies of DNA…
Q: The technique of gel electrophoresis gives scientists an effective way to see some differences…
A: DNA stands for deoxyribonucleic acid. It is a double helix made up of two polynucleotide chains that…
Q: which process releases the DNA into the ionic medium? a. homogenization b. deproteination c.…
A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…
Q: Which one is an example of nucleic acid hybridization? A the template and newly synthesized DNA…
A: Nucleic Acid hybridization is a molecular biology technique in which single stranded nucleic acids…
Q: When a dideoxyribonucleotide is incorporated into a growingDNA strand,a. the strand elongates…
A: Given: Explain when a dideoxyribonucleotide is incorporated into a growing DNA strand, choose the…
Q: Give the DNA compliment to the following DNA strand. CTA a DNA BTW GAT СТА
A: DNA is the Genetic meterial which found in eukaryote and some prokaryotes. It is mainly double…
Q: In the figure, which ketter represents DNA polymerase 1 D AR AA BB C.C DD EE
A: Polymerase A kind of enzyme that make DNA or RNA from pre-existing DNA or RNA.
Q: Enzyme that combines the 2 DNA fragments from different organisms O Recombinant DNA Technology O…
A: Recombinant DNA technology is a biotechnological technology that uses various tools and techniques…
Q: B. Make identical strands of DNA CCTAT ATCTC TCTAT ATCTC TCATA CTGTG TGTCT CTATA (original) (new) C.…
A: The newly synthesized strand would always be complementary to the original DNA (and with opposite…
Q: The backbone of DNA molecule is made of? a. nucleotides b. alternating phosphates and bases…
A: DNA is the genetic material in all the living organisms.
Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…
A: High quality DNA means that A260/A280 ratio is between 1.8 to 2 whereas a ratio closer to 1.8 is…
Q: When two adjacent bases in the same strand of DNA dimerize (form a covalent bond between them), what…
A: DNA (Deoxyribo nucleic acid ) is a double stranded structure which contains genetic information. It…
Q: Choose the combination of answers that most accurately completes the statement. Why must the lagging…
A: DNA is deoxyribonucleic acid. It contains the genetic information that is transmitted from one…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA TCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a thread-like chain of nucleotides. The order of these nucleotides determines the information…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dnawhy is recombinant DNA is possible becuase we know dna molecules from all organisms share the same chemical structure and differ only in the nucleotide seqeunce within the identical structureA. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
- Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: LeucineI need help with a biology lab question, a DNA isolation lab Cold temperatures were used to cause the DNA to flocculate (form larger comples). What was the purpose of adding isoporpyl alcohol to the mixture? Hint: DNA dissolves in water and undissolves in alcohol.DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
- 5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. FCan you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient. Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands. Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…no explanation necessary! Letter of answer only. Part I: Multiple choice 1. The DNA base pairing rules are: a) Any combination of the bases. b) T pairs with C, and A pairs with G. c) A pairs with T, and C pairs with G. d) C pairs with A, and T pairs with G. 2. DNA in cells is damaged: a) Millions of times a day. b) By collisions with other molecules or by chemical accidents and radiation. c) Not very often¸ and by radiation only. d) a and b 3. For genes that code for proteins, which molecule conveys the information from the gene to the ribosome? a) DNA b) mRNA c) tRNA d) rRNA 4. Which of the molecules below is produced during replication? a) mRNA b) rRNA c) tRNA d) DNA 5. Why is there a difference between the synthesis of a lead strand and that of a discontinuous strand in DNA molecules? a) The origins of replication are found only at end 5' of the molecule. b) Helicase and protein factors act at the extremity of 5'. c) DNA polymerases can only add new nucleotides at the extremity 3' a…
- You are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itselfWhich of the following is/are true regarding the enzyme primase? a: primase functions during cellular DNA replication. b: without primase activity, DNA polymerase in our cell can NOT begin synthesizing new nucleotide chains. c: primase uses dNTP building blocks d: primase is a polymerase enzyme e: primase functions AFTER DNA helicase activity. Ps: This has multiple answers. thank you.