DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC TTT GCA TTA 5' The DNA strand whose %A is 16.7%
Q: Do you think obesity is a choice? What are the influences of lipids/fats mechanism in the body to…
A: Lipids are vital micronutrient that helps our body to absorbs nutrients , made hormones, even cell…
Q: When activated extracellularly, G protein-coupled receptors (GPCRs) initiate which of the following?…
A: Introduction: G-proteins referred to as guanine nucleotide-binding proteins, that are required for…
Q: Treatment of a polypeptide with 2-mercaptoethanol yields two polypeptides 1.…
A: Given that treatment of a polypetide with 2 mercaptoethanol yielded 2 polypeptides: 1.…
Q: If a person consume their average kcalorie intake per day over a month, assuming no change in…
A: A calorie is a unit of energy, just like a kilogram (kg) is a unit of weight and a kilometre (km) is…
Q: 25- General formula of alkyne compounds are.
A: CnH2n-2 an alkyne is an unsaturated hydrocarbon containing a carbon-carbon triple bond. the simplest…
Q: List at least two (2) importance/applications of systematic separation of cations into groups in…
A: Cations are very crucial for the body and hence, their proper detection and identifying their…
Q: Quest: 2 Alleppt any Two a write a note on oxidative phosphorylation 1 Describe induced fit theory…
A: Enzymes are protein molecules that take part in speeding up biological reactions. Biological…
Q: the chemistry behind the buffer system in blood.
A: In biological research, buffers are frequently used to keep the pH of particular processes constant.…
Q: Which of the sugars in the following figure is/are D sugars? Choose all correct answers. CHO CHO CHO…
A: First question: D-configuration refers to any chemicals that can be linked to (+)-glyceraldehyde…
Q: Which of the following carbohydrates function as a major source of cellular fuel? a. starch in plant…
A: Introduction: Carbohydrates are large biomolecules that are present abundantly on the earth. It…
Q: Give a precise definition of the porphyrin ring, explain how it relates to ions and molecules, and…
A: Porphyrins are a class of heterocyclic macrocycle organic compounds made up of four modified pyrrole…
Q: The first step of the lysozyme reaction (catalytic mechanism) is shown in the figure below. Which…
A: Lysozyme is an antibacterial enzyme that cleaves the β 1→4 glycosidic COO- bond between the…
Q: Inhibitory postsynaptic potentials cause what type of change at the post-synaptic membrane?…
A: Introduction: Post-synaptic potentials are neurotransmitter receptors that mediate changes in…
Q: In the pathogenesis of atherosclerosis, small oxidized LDLs…. a) are internalized in artery…
A: Atherosclerosis is a disease characterized by thickening or hardening of arteries due to…
Q: Many early attempts at enzyme engineering tried to design so-called catalytic antibodies. This…
A: Enzymes function by lowering the activation energy of the transition state of a chemical reaction.…
Q: All are both ketogenic and glucogenic amino acids except Group of answer choices Tyrosine Arginine…
A: Glucogenic amino acids are those that can be transformed to glucose through the process of…
Q: From what DNA base sequence was the following mRNA sequence transcribed? 5’ – UUCGAG – 3’
A: Transcription: It is a process of synthesis pf mRNA from double stranded DNA by the enzyme RNA…
Q: In the phase- II molabaliem given some options below in which Choose the accid who not participant…
A: Introduction: Drug metabolism refers to the enzyme-mediated biotransformation that modifies the…
Q: Which of the following statements is false? a. A reaction may not occur at a detectable rate even…
A: The rate of reaction is described as the speed through which there is a process of a chemical…
Q: Hi! Can you give an explanation for each sample identity in paragraph form (for the rationale)?…
A: Introduction: Carbohydrates are large macromolecules that contain three essential elements which are…
Q: TRUE OR FALSE 1. The bacterial reactions that lead to the spoiling of milk proceed much slower at…
A: Note: Since you have posted a question with multiple subparts, we will solve first three sub parts…
Q: When people are talking about ways to lose weight, cutting out carbohydrates is always on the…
A: General myths are: 1. Dieting (Less eating or skipping meals) to reduce weight 2. Skipping just the…
Q: Based in your learning in this course, from what process was the siRNA cell protection mechanism…
A: As per the literature so far, there are many theories suggesting the evolution of siRNA cell…
Q: What is biochemistry
A: Biochemistry is the branch of science that investigates the chemical processes that take place…
Q: b and c please.... explain wel
A: Thank you for your question, Answers for the following question with detail explainations are given…
Q: ubiquitin attaches to proteins via many biochemical reactions, please explain how this attachment…
A: Ubiquitin is a highly conserved 76-residue monomeric protein found in eukaryotes. It is found in…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: Introduction: The term equilibrium constant (Keq) shows us the relationship between reactants and…
Q: True or False In the presence of enzymes, the value of free energy of activiation (delta G°‡) for…
A: Enzyme: It is a biocatalyst that increases the rate of chemical reaction by lowering the the…
Q: 1. The DNA strand which is mostly like to form DNA Z DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA…
A: We are authorized to answer one question at a time since you have not mentioned which question you…
Q: What would the tertiary structure of the dipeptide Asp-Ser be if it was made into a polypeptide…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: the maximum amount of ATP that could be generated by the full oxidation of the compound…
A: In the given question, the fatty acid mentioned is CH3(CH2)4COOH. Here full oxidation means…
Q: . When digesting a complex carbohydrate, water is added and, a simple sugar is obtained through…
A: During digestion the large molecules are broken down into simple molecules like during protein…
Q: What constitutes the backbone of a nucleic acid?
A: Introduction: A nucleic acid is a biological large molecule composed of nucleotide chains. These…
Q: The concentrations of pyruvate, NADH, H+, lactate, and NAD are 2, 1.5, 1.5, 1.2, 1.2 mm,…
A: The quantitative study of the energy change from one form to another in the living cells and of the…
Q: 3. Which of these are correct combinations of monosaccharides forming disaccharides? I. Glucose +…
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the…
Q: Describe/Explain each of the following: 1. Salivary Digestion 2. Gastric Digestion 3. Intestinal…
A: Digestion is a process of breakdown of big food pieces into small pieces with that help of teeth and…
Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…
A: As per guidelines, we are author to answer only first-three sub parts of first question only.…
Q: Draw the structure of 1-linolenyl-2-arachidyl-3-phosphatidylserine
A: Phosphatidyl serine is a glycerophospholipid composed of fatty acids, phosphate group, serine, and a…
Q: The liver is the largest organ in the body and it performs several vital functions. What are the two…
A: Liver being largest internal organ located on the upper right side beneath the diaphragm and above…
Q: For each of the following descriptions, match the corresponding enzyme: Utilizes a ATP for…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Tertiary structure of a protein describes * The order of amino acids Location of disulphide bonds O…
A: The structure of a folded protein is organized at four different levels- the primary, secondary,…
Q: 10-7. A classic paper studied the behavior of lipids in the two monolayers of a membrane by labeling…
A: Lipid bilayer: It is a polar membrane made up of two layers of lipid molecules that is very thin.…
Q: Using the information below, calculate the Oxygen Diffusion Driving Force (mmHg), which is the…
A: The alveolar gas equation is PAO2= FiO2 (PB-PH2O)- (PaCO2/R), where, PAO2 is partial pressure of…
Q: What is the biological advantage to the sigmoidal binding curve of hemoglobin for oxygen? A. It…
A: The binding of oxygen to the haemoglobin increases with increase in oxygen partial pressure, Maximum…
Q: In biochemistry, the term “Pi” is used as a shorthand for: the inorganic phosphate ion in any of…
A: Phosphorus and phosphate are present inside the cell. It helps in the phosphorylation of many…
Q: An allosteric interaction between a ligand and a protein is one in which: a. binding of a molecule…
A: Catalysis occurs at the active site, which is a specific location on the enzyme. Additional sites…
Q: Why is cellulose considered “fiber” in your diet but starch is not? In your answer, refer…
A: Fibers have lots of important roles in the human health. It helps in the prevention of constipation…
Q: Which of the following factors is responsible for the denaturation of proteins? * Oa) Heat Ob)…
A: Denaturation of any protein includes a number of weak bonds or weak linkages, that occur within a…
Q: Describe the importance of Wee1, Myt1, CAK and cdc25 activity on the activation of the cyclin B/CDK1…
A: CDKs are the proteins whose concentration increases or decreases during the cell cycle. The…
Q: In order to sediment mitochondria, you were asked to centrifuge at an RPM of 5600 to give an RCF of…
A: The relative centrifugal force (RCF) is the radial force that is generated in a spinning rotor that…
Step by step
Solved in 2 steps
- If a segment of DNA is 5 CATTAC 3, the complementary DNA strand is (a) 3 CATTAC 5 (b) 3 GTAATG 5 (c) 5 CATTAC 3 (d) 5 GTAATG 3 (e) 5 CATTAC 5Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:For each species, all ________ in the complete set of chromosomes is the ________. a. genomes; library b. DNA; genome c. mRNA; start of cDNA d. cDNA; start of mRNA
- Match each term with the most suitable description. ______ DNA profile a. GMO with a foreign gene ______ Ti plasmid b. alleles commonly have them ______ probes c. unique array of short tandem repeats ______ SNPs d. used to find clones. ______ transgenic e. mouse vs. human ______ genomics f. used in plant gene transfers ______ CRISPR g. based on RNA interferenceTranslate the .sequence of bases in the previous question, starting at the second base.Writing a Full Strand:1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT Complementary DNA:_______________________________________________________________________ B. Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT (original) ______________________________________________________________________ (new) _____________________________________________________________________ (new) ______________________________________________________________________ (complementary from 1A)2. A. Original DNA: CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT Complementary DNA: _______________________________________________________________________ B. Make identical strands of DNA CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT (original) _______________________________________________________________________ (new) ________________________________________________________________________ (new)…
- 1. The DNA strand whose %T is 50% DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: B, D, A, C, none of the above 2. The DNA strand that has the highest melting point? DNA M = 5' GGG GCT AGC CCC 3' DNA N = 3' ATA TAT ATA CCC 5' DNA O = 5' TAC GTT ACG TCG 3' DNA P = 3' ATC TTT GCCA TTA 5' Choices: N, O, P, M, none of the above 3. The DNA strand whose complementary DNA has a GGG at the 3' end DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: B, none of the above, A, C, DStacking of bases in B form DNA 1. Is mostly interstrand. 2. Occurs due to Van der Vaals interaction between the bases. 3. Occurs due to hydrogen bond formation between the bases. 4. Is strongly affected by G/C content.5’ ATGCTAGACGTGTTCTAG 3’3’ TACGATCTGCACAAGATC 5’Moving from left to right, the bottom DNA strand will be read continuously.a. Tb. F
- ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of nucleotides. 1. Write the complementary DNA strand to the above sample. 2. Write the RNA complementary strand to the original DNA strand.4) Repetitive DNA comprises about _________ of chromosomal DNA A) 5% B) 40% C) 60% D) 95%1. The DNA strand which is mostly like to form DNA Z DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: A, none of the above, B, C, D 2. The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: none of the above, A, B, C, D 3. The DNA strand of an organism living in volcanic vents is likely to be DNA W = 5' GGG GCT AGC CCC 3' DNA X = 3' ATA TAT ATA CCC 5' DNA Y = 5' TAC GTT ACG TCG 3' DNA Z = 3' ATC TTT GCCA TTA 5' Choices: W, X, Y, Z, none of the above 4. The DNA strand that is most likely to be a promoter sequence DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: A, B, C, D, none of the above