Answered: When referring to attenuation in the…

Name: When referring to attenuation in the regulation of the trp operon it w
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, ________. tryptophan inactivates the repressor proteintranslation termination of the t

Science

Biology

When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, _

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 9TYU: A mutation that inactivates the repressor gene of the lac operon results in (a) the continuous...

See similar textbooks

Similar questions

The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.
The figure at the beginning of this chapter showsthe binding of both a Lac repressor tetramer and aCRP-cAMP complex to the regulatory region of thelac operon.a. What is the key feature of a regulatory protein suchas the Lac repressor or CRP that allows it to regulate specifically the genes or operons it is supposedto control?b. On the figure, show the positions of the followingcomponents: (i) A Lac repressor monomer; (ii) a Lacrepressor dimer; (iii) all four DNA binding domains ofthe Lac repressor tetramer; (iv) a single helix-turnhelix motif; (v) the o1 part and either the o2 or o3 partsof the lac operator (assume the operon would be transcribed from right to left on the figure); (vi) themultimerization domains of the four Lac repressormonomers; (vii) an inducer-interacting domain; (viii)the CRP-cAMP complex; and (ix) a DNA loop.c. What is the physical basis for the formation of theDNA loop shown in the figure?d. On the figure, show the position of two axes ofsymmetry in the sequence…
You are growing E. coli in a laboratory in order to study their operons. The growth media you are using contains lactose, no glucose and no tryptophan. Using your knowledge of operons and their regulation, answer the following questions using the dropdown menus provided in Canvas. Which operons would be functional under these conditions? What repressors would be made? (NOTE: name the repressors using their gene names) Which repressor(s) would be made in the inactive form? Which repressor(s) would be made in the active form? Which repressor(s) under these conditions can bind the operator sequence?
You are growing E. coli in a laboratory in order to study their operons. The growth media you are using contains lactose, no glucose and no tryptophan. Using your knowledge of operons and their regulation, answer the following questions using the dropdown menus provided in Canvas. Which operons would be functional under these conditions? What repressors would be made? (NOTE: name the repressors using their gene names) Which repressor(s) would be made in the inactive form? Which repressor(s) would be made in the active form? Which repressor(s) under these conditions can bind the operator sequence? Which repressor(s)under these conditions cannot bind the operator sequence? What effect does lactose have on the bacterial cell’s lac operon? What does the absence of glucose do to the bacterial cell? You now add tryptophan to the cell. What would happen to the bacterial cell and its trp operon? What kind of regulation does lactose provide to an operon’s…
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
The following statement occurs early in this chapter:“. . . a crucial step in the regulation of many bacterialgenes is the binding of RNA polymerase to DNA atthe promoter.” Why might it be advantageous forbacteria to regulate the expression of their genesat this particular step?
An E. coli cell as the following genotype for the lac operon system: I- OC Z+ / F’ I+. Which term best describes the regulation of expression of the beta galactosidase in this cell? Group of answer choices Inducible None of these Activated Always repressed Constitutive
please answer Why is it useful to have two different mechanisms of positive regulation? I.e. why would cells have both AraC and CAP-cAMP as activators in the Arbinose operon.
You are growing E. coli in a laboratory in order to study their operons. The growth media you are using contains lactose, no glucose and no tryptophan. Using your knowledge of operons and their regulation, answer the following questions I really need a in depth epxplantion for the queshtions to make sure i understand the answers a.What effect does lactose have on the bacterial cell’s lac operon? b.What does the absence of glucose do to the bacterial cell? c.You now add tryptophan to the cell. What would happen to the bacterial cell and its trp operon? d.What kind of regulation does lactose provide to an operon’s repressor?
Imagine that a new strain of E. coli is discovered, and it contains the following novel genetic region including the lacI gene and the lac operon: *see image* Upstream of the promoter associated with the lac operon, there is a new operator element "Oν" (O-"nu"). This new operator has high sequence homology to O1, the DNA element that is bound with the highest affinity by the lac repressor. What would be the impact of this new genetic element regarding behavior of the operonin the absence (vs. the presence) of lactose and allolactose? Answer in terms of the protein levels of the lac repressor, as well as the proteins encoded by the genes lacZ/Y/A in the downstream region of the operon. Remember that proteins, once expressed/generated, will not persist forever, and that they have a natural lifetime (ending when they are degraded by the cell).
You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH, andhupG. Diagram the mRNA for this operon, showingthe location of the 5′ and 3′ ends, all open readingframes, translational start sites, stop codons, transcription termination signals, and any regions thatmight be in the mRNA but do not serve any of thesefunctions.
The promoter of an operon is the site to which RNApolymerase binds to begin transcription. Certain basechanges in the promoter result in a mutant site towhich RNA polymerase cannot bind. Would you expect mutations in the promoter that prevent binding ofRNA polymerase to act in trans on another copy ofthe operon on a plasmid in the cell, or only in cis onthe copy immediately adjacent to the mutated site?