When your white blood cells encounter pathogens, they use harsh chemical reactions to destroy pathogens. During these chemical reactions, some harmful compounds called free radicals are generated. Free radicals are important for destroying pathogens, but if they accumulate in our cells, they can cause damage to our own cells, too. They can damage our DNA and proteins within our cells. How is vitamin C involved in these immune processes? Which ONE is correct? 1 Vitamin C is a coenzyme in the chemical reactions that produce free radicals. 2 Vitamin C is an antioxidant that prevents free radicals from damaging cellular components. 3 Vitamin C assists in the formation of collagen, which destroys pathogens. 4 Vitamin C assists in the synthesis of phospholipids to repair damaged cell membranes.

Q: Which of the following types of immunity is non- specific? adaptive exposed innate interest 0000

A: The ability of the body to resist harmful pathogens and foreign substances is referred to as…

Q: 5. We have 100 mL of 5X TBE (Tris/Borate/EDTA) solution and need to make 1 L of 2X solution. Solid…

A: Using formula, C1V1=C2V2

Q: Make a thesis introduction of the topic " Cat Taxidermy". Cite your citation with url.

A: A thesis is a statement or central argument that a writer puts forward and supports through evidence…

Q: The Warburg effect is generally observed in cancer cells as a consequence of pyruvate dysmetabolism.…

A: Introduction :- p53 is a tumor suppressor protein that plays a critical role in regulating cell…

Q: 9. F. A. B. E. C. D. The allele for normal skin pigmentation (A) is dominant to absence of…

A: Introduction :- Albinism is a genetic condition characterized by a lack of pigmentation in the skin,…

Q: Which chemical equation represents aerobic cellular respiration? a) C6H12O2 → 2 C3H₂O b) 6 CO2 + 6…

A: Introduction  Cellular respiration is the process by which cells convert nutrients, especially…

Q: nuclear lamina nuclear pores,

A: In eukaryotes, nucleus are membrane bound organelle which contain genetic information. This genetic…

Q: You would like to create new hybrid strains between various cereal grains of different ploidies.…

A: Sterility usually results from different chromosome numbers in the parents, when the parents are…

Q: How many coccus cells (0.0005 mm in diameter) could fit across the entire FOV of the 100x  objective…

A: Introduction  Magnification is the ratio of the apparent size of an object to its actual size. In…

Q: Consider a maize plant: Genotype C/cm ; Ac/Ac+ where cm is an unstable colorless allele caused by Ds…

A: Phenotype ratio refers to the relative proportion of observable traits or physical characteristics…

Q: Question 6 Using the cookbook analogy, match the statement with the part of the cookbook: A Cookbook…

A: Introduction  DNA (Deoxyribonucleic Acid) is a molecule that contains genetic instructions for the…

Q: what are the effects of the psychostimulants on the fetus?

A: Psychostimulants are a class of drugs that stimulate the central nervous system (CNS) and increase…

Q: Temperature (°C) 40 38 36 34- 32 30 28 0 2 Time (h) 3 Wild type (WT) UCP1 deficient 4

A: Mammals (including mice) are homeotherms that means they can maintain there body temperature at a…

Q: How does the hen “rock” the egg?

A: A hen egg is the egg produced by a female chicken, also known as a hen. It is a common type of egg…

Q: Discuss the chimpanzee species

A: Chimpanzee is a species of great ape that belongs to the Hominidae family. They are one of the…

Q: Differences and similarties of ester and glycosidic linkage?

A: Ester and glycosidic linkages are two types of covalent bonds that are commonly found in biological…

Q: what are the neurotoxic effects of methanphetamine on the brain?

A: Methamphetamine is a highly addictive psychostimulant with neurotoxic effects on the brain. Chronic…

Q: 17. In the video, Dr. Lara discusses the results of a meta-analysis published in 2013 by Harri…

A: Vitamin C, also known as ascorbic acid, is a water-soluble vitamin that plays a crucial role in…

Q: hi can you please help me review this vedio including vedio topic presented, the information…

A: Bioterrorism refers to the deliberate release of biological agents such as viruses, bacteria, or…

Q: In which order do the stages of aerobic cellular respiration occur? O a) glycolysis, citric acid…

A: Glycolysis - The breakdown of glucose into two pyruvate molecules in the cytoplasm of the cell.…

Q: What method did the research team use to identify the ARGs and how did they quantify them?

A: A research paper is a written document that presents the results of original research conducted by…

Q: Strand directed mismatch repair corrects copying erros based on Which of the following apply to the…

A: Methylation refers to the addition of a methyl group (-CH3) to a molecule. methylation most commonly…

Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC

A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…

Q: 1. With "Threshold and Sensitivity," can you describe the "inverse" (or oppostite) relationship…

A: Introduction  Age is a term used to describe the amount of time that has passed since an individual…

Q: Compare How does the gestational period of humans compare with that of the other species listed in…

A: In placental mammals, the time taken by an offspring from fertilization to being born is referred to…

Q: Which of the following electrolytes are absorbed only when needed a. Iron O a O b b. Calcium c.…

A: Introduction - Electrolytes are substances that, when dissolved in water or other solvents, can…

Q: garden peas tall vine is dominant over short vine and round pea pod is dominant over wrinkled pea…

A: Introduction: The phrases heterozygotes and homozygotes are used to characterise a person's genetic…

Q: https://pubmed.ncbi.nlm.nih.gov/28671715/ Discuss the chimpanzee species is an endangered, by using…

A: A chimpanzee is a great ape and one of the closest living relatives to humans. They are native to…

Q: can you please help to write review on this vedio please…

A: Psychology is the scientific study of the human mind and behavior. It encompasses various subfields…

Q: In the liver, what is the fate of pyruvate under conditions of the Cori Cycle? Acetyl CoA to fuel…

A: Cori cycle is a metabolic pathway in which lactate in muscles is transported to liver where it is…

Q: You have made several mutations in the coding region of the gene coding for the sodium channel and…

A: mutation is a permanent change in the DNA sequence of a gene or a chromosome. This change can occur…

Q: Mention 5 cow research titles

A: Cows are the primary animals that are used for their milk production and for meat.  The researchers…

Q: 1. Use the words presented in below to create a concept map illustrating the relationships among…

A: The "Five I's" framework by Cowan and Smith (2018) is a commonly used approach for microbiological…

Q: Oxidative phosphorylation involves the direct formation of ATP by the flow of protons through a…

A: Electron transport chain and oxidative phosphorylation are the two coupled processes that occur in…

Q: The alternative fate of pyruvate in the mitochondrial matrix is the conversion of pyruvate to…

A: In the absence of oxygen, pyruvate goes through reduction. Lactate is created when pyruvate is…

Q: I do a lot of things to improve my cardiovascular system. As a soccer player, I need to be…

A: The condition of the heart and blood arteries is referred to as cardiovascular health. Heart and…

Q: In a vacuum, all electromagnetic waves have the same speed. frequency O wavelength. O amplitude.

A: Introduction: The electromagnetic spectrum is the range of all types of electromagnetic radiation.…

Q: Part II. Solving Genetics Problem. Do what is asked. Show your solution. A. Monohybrid Cross 2. Long…

A: Introduction :- A monohybrid cross involves the breeding of two individuals that are heterozygous…

Q: Is the following claim true or false: science, and inquiry more generally, is a normative activity.

A: Research can identify gaps in our knowledge and understanding about any concept which can help to…

Q: Give possible thesis title on seaweeds and enumerate 3 objectives

A: A thesis is a long-form academic paper that presents an original research study or argument on a…

Q: A 55-year-old male was diagnosed with rheumatoid arthritis (RA) after experiencing complications…

A: Rheumatoid arthritis is an autoimmune disease. An autoimmune disease refers to when the body's…

Q: This UCP1 protein allows the protons (H+) of the mitochondrial intermembrane space to enter the…

A: UCP1 is a unique protein that plays a critical role in thermogenesis and energy balance, and it may…

Q: hi can you please help me review this vedio including vedio topic presented, the information…

A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a revolutionary gene-editing…

Q: Make a Research Gap on the topic "Habitat Niche Partitioning of Anurans in Waterfalls". Cite your…

A: Habitat: A habitat is the natural environment or home of a particular organism or group of…

Q: The 100-milligram dose of vitamin C provided by this dietary supplement is and why   1 less than…

A: Vitamin C, also known as ascorbic acid, is a water-soluble vitamin that plays several important…

Q: Under aerobic conditions when glucose is limiting, with high ratios of NADH/NAD+ and ATP/ADP, as…

A: Introduction :  Glycolysis is a metabolic mechanism that occur in both aerobic and anaerobic…

Q: What are the medical/ therapeutic applications of the nucleotide sleectivity?

A: Introduction :- Nucleotide selectivity refers to the ability of certain drugs or therapies to…

Q: Assume that a gene controls the expression of a trait in which affected children occur only in…

A: Using a Punnett square can help us to understand better the principles of inheritance and how they…

Q: Which of the following best describes the use of 2-deoxyglucose in allowing for cancer therapy?…

A: Introduction :- 2-deoxyglucose is a glucose analog that can inhibit glycolysis, the process by which…

Q: In the lungs what is the occurring with respect to the [H+] of the microenvironment of the red blood…

A: Introduction :  The red blood cell contains the iron-containing pigment known as haemoglobin.…

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.