Answered: Which are adapatations that can permit…

Which are adapatations that can permit an organism to better survive (select all that apply? A. behavior b. psychiological c. evolutionary process d. Particular structure

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter11: Evolution And Its Processes

Section: Chapter Questions

Problem 8RQ: The wing of a bird and the arm of a human are examples of ______. a. vestigial structures b....

See similar textbooks

Related questions

Q: Explain the signs and symptoms of human parvovirus B19 infection *keep it short to the point

A: Parovirus B19 replicates in mitotically active cells mostly in red blood cells. Paroviruses are…

Q: Stain: Stain reaction (Result): Morphology: Arrangement:

A: Staining is done in order to see the bacteria in clinical specimens. Stains are used to produce…

Q: Task 5 A. Define the term epistasis. B. Labrador retrievers have 3 varieties of fur colour: yellow,…

A: Introduction :- Epistasis is an important concept in genetics as it helps to explain the complexity…

Q: hallmarks of an autosomal recessive trait

A: The hallmark feature of an autosomal recessive trait are:…

Q: explain the following: P→ Parental generation. G → Gametes. F1→ First filial generation. F2→ Second…

A: Here the phenotye choosen is stem length. Long stem length is dominant over short stem length. Let L…

Q: Men are generally stronger than women because they typically have larger bodies, and a more…

A: Introduction Muscles are a type of tissue that enables movement in the body. They are responsible…

Q: In a population of 199 individuals, a locus has two alleles: E and e. If 33 individuals have the ee…

A: Introduction : According to the Hardy-Weinberg principle, allele frequencies in a population are…

Q: Which organelle is the considered the power house of the cell in animal cells, and what part of…

A: Introduction An organelle is a tiny structure found inside a cell that performs a specific function…

Q: The figure below shows a comparison between humans (Homo sapiens) and each of the listed species for…

A: Introduction :- The mitochondrial genome refers to the complete set of DNA located in the…

Q: Describe the anatomical and directional terms in locating the digestive structures of toad, fish and…

A: Introduction :- The digestive system is a series of organs that work together to break down food,…

Q: 5. What accessory structures (not the main digestive organs) contribute to EACH of the FOUR…

A: Biomolecules are defined as organic molecules secreted and/ or synthesized as well as required by…

Q: individuals make productive use of the web? Can you explain the main distinctions between…

A: telemedicine and telesurgery belong to the field of telehealth, which encompasses the delivery of…

Q: Catastrophism founded the science of paleontology. true or false

A: Introduction :- Paleontology is the study of fossils, which are the remains or imprints of ancient…

Q: The NMDA receptor I/V curve is nonlinear, why? What about the GluA2-containing AMPA receptor I/V…

A: Introduction: The nervous system, a complex network of specialized neurons and supporting cells…

Q: The integral membrane protein XYZR has a single alpha helix spanning the membrane. Where was this…

A: INTRODUCTION Integral membrane proteins are proteins that are embedded in biological membranes.…

Q: Short Bones: Pick your favorite short bone. What is it? Draw it. Draw its markings. Label the bone's…

A: Short bones are small bones that generally do not have a long axis, such as the carpal and tarsal…

Q: When you measured your DNA preparation concentration using the NanoDrop spectrophotometer, it…

A: Introduction: DNA stands for Deoxyribonucleic Acid, which is a molecule that carries genetic…

Q: 29. Observe this chemical reaction to answer the following questions (29a through 29h). "Reaction…

A: Note: Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: For each statement below, indicate whether it is True or False. (Enter 1 for True and 2 for False).…

A: Introduction A population refers to a group of individuals of the same species living in a specific…

Q: esc Which of the following is an organ through which nutrients, gases, wastes are exchanged? 1…

A: Introduction :- The cloaca is a term used in anatomy to refer to a common cavity in which the…

Q: Careless Kris is using the microscope for the first time to look at cells and breaks a slide at high…

A: Introduction :- An objective lens is a type of lens that is located on the microscope near the…

Q: Describe and compare human prion infections

A: Ptions are the infectious particles made up of misfolded proteins. Genetic prion diseases are caused…

Q: Define the term 'distributive shock' and briefly explain why two of the three types of distributive…

A: The humans or other vertebrate's complete body is pumped by a group of organs called the blood…

Q: - what convinces that we are not just on the way but on the 6th mass extinction already? Explain a…

A: An average definition of a mass extinction is the loss of about 75 percent of all species on Earth…

Q: CO-DOMINANCE/I... 2/3 | All 1 87% + 3. A homozygous red gummy bear is crossed with a homozygous…

A: Introduction :- A Punnett Square is a tool used to predict the offspring of a genetic cross between…

Q: Create an A3 poster that demonstrates the following genetic concepts: The difference between…

A: The differences observed in individuals for a particular trait is mostly related to their genotypes…

Q: []] Book of the Dead: The Species Declared Extinct in 2022 - What are the COMMON reason for these…

A: Introduction: Extinction of species refers to the permanent loss of a species from the Earth, such…

Q: 4 Identify the phylum (or supergroup) to which this organism belongs AND identify its mode of…

A: Phytoplankton are microscopic, photosynthetic organisms that float in aquatic environments and form…

Q: Compare and contrast fibre types.

A: Introduction: Skeletal muscle is a type of muscle that is attached to the skeleton and is…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: Differentiate the activity of an RNA-dependent RNA polymerase when functioning as a replicase and…

A: Introduction :- In transcription, the DNA double helix unwinds and one strand acts as a template for…

Q: In a certain plant, red flowers are dominant over white flowers. A plant heterozygous for red…

A: When two different variants of a trait exist at the gene level, they are referred to as dominant and…

Q: Which of the following statements about the DNA is FALSE? O DNA occurs in the form of double…

A: Deoxyribonucleic acid (DNA) is the genetic material of the cell. It has the information for…

Q: Genetic drift can produce large changes in allele frequencies in a short time period. true or false

A: There are a few important points: Evolution is a process that results in changes in the genetic…

Q: In point form, describe and explain how the organelles listed play a role in each major function in…

A: Introduction :- The mitochondria are known as the "powerhouses" of the cell because they produce…

Q: 5) Contrast bone modeling and bone remodeling: a) bone remodeling makes the bone grow wider, while…

A: Ossification is the process by which immature cells called osteoblasts lay down new bone material…

Q: Centromeres of a single homologous chromosome are pulled to opposite poles during

A: Introduction :- Centromeres are a region of a chromosome that play a crucial role in cell division.…

Q: can someone explain these calculations to me?

A: At first, a standard curve is made using the OD of protein of known concentrations, i.e., ODs…

Q: 4. What four main molecular components make up a phospholipid like phosphatidylcholine? (Note: if…

A: Introduction : Organic molecules that are insoluble in water are referred to be lipids. These…

Q: What is the calculated “critical value” for this problem?

A: Hypothesis testing is the first step in any experimental research. At this step, two types of…

Q: Part II-Autosomal Dominant Traits "Great, so this looks like an accurate representation of your…

A: Given - Myotonic dystrophy is an autosomal dominant genetic disorder. Greg has an uncle, aunt and…

Q: or F Edge habitat always provides differential access to one habitat t

A: Introduction: The ecological response to habitat refers to the changes in species composition,…

Q: An anticodon is 5' CGA 3. The codon that pairs with the anticodon will be FOOD An anticodon is…

A: Introduction Gene expression is the process by which the information stored in a gene, in the form…

Q: Discuss the role of Public Health at the community and national levels. Identify what you believe…

A: Public health is the branch of medicine concerned with improving the health of communities and…

Q: All of the following changes take place during the last trimester of pregnancy EXCEPT- a, the…

A: Pregnancy is the state in which a woman carries a developing embryo or fetus within her uterus. It…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…

Q: scientists continue exploring other planets and our solar system, they seek evidence to prove that…

A: Introduction: The composition of molecule of water (H2O) is made up of two hydrogen atoms and one…

Q: What is your overall dilution factor if you complete 3 serial dilutions using a 100-fold dilution…

A: Introduction Dilution is the process of making a solution weaker or less concentrated by adding…

Q: At Elmhurst hospital in Queens, a couple originally from the South Indian city of Bengaluru bring…

A: The situation in the waiting room of Elmhurst Hospital in Queens is tense. A couple originally from…

Q: Work N1. Initial isolation of pure culture aerobic microorganisms from mixture of bacteria mixture…

A: In microbiology, a pure culture is a lab culture that contains only one species of organism. By…

Concept explainers

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth. Human evolution is an outcome of interaction among the following processes:

Question

Which are adapatations that can permit an organism to better survive (select all that apply?

A. behavior

b. psychiological

c. evolutionary process

d. Particular structure

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which best describes the relationship between chimpanzees and humans? a. chimpanzees evolved from humans b. humans evolved from chimpanzees c. chimpanzees and humans evolved from a common ancestor d. chimpanzees and humans belong to the same species
What do scientists in the field of systematics accomplish? a. discover new fossil sites b. organize and classify organisms c. name new species d. communicate between field biologists
Which evolutionary pattern is represented by the similarities between these two organisms that live on separate continents? a.) coevolution b.) convergent evolution c.) directional evolution d.) divergent evolution
From natural selection, hypothesize what kinds of adaptations might happen to a group of organisms of penguin due to increasing globaltemperatures
Which is the best description of evolution? A. Animals become more complex over time. B. Plants become more complex over time. C. Life changes over time. D. Allele frequencies change in a population.
Which is a characteristic of pseudoscience or bad science? a) Considers evidence for and against a hypothesis B)Includes personal experiences as data c) srepeatable d) Publishes in a peer-reviewed journal
Which is a characteristic of pseudoscience or bad science? a. Publishes in a peer-reviewed journal b. Is repeatable c. Considers evidence for and against a hypothesis d. Includes personal experiences as data
In 3-6 well devloped snetences answer the question: Define Anatomical position. Why is it important to know anatomical position and how is anatomical position used in medicine and science?
Use studies of natural selection in British moth populations to illus-trate the hypothetico-deductive method of science
The chelipeds of prawns are quite diminished in size when compared to crayfish and lobster.Hypothesize why you think these differences exist? Find some support for your hypothesis from the Internet or other scientific resource.
The scientific name for the mountain lion is Puma concolor. a. Determine part of the name that represents the genus. b. Which part of the name represents the species? b. Explain the advantage of the scientific naming to the common naming of organisms.
Galton put a lot of emphasis on investigating... a.Differences among individuals. b.Small samples. c.Learning. d.Animals.