Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT COULD APPLY secondary O primary O tertiary quaternary

Q: Rg of laterial that có (carbon) and 0.5% N (nitrogen) would likely be (assuming that 35% of the carb...

A: The composition of soil organic matter averages about 5% nitrogen and 50-60% carbon. A soil with 1% ...

Q: In earlobes, free (F) earlobe is dominant while attached (f) earlobe is recessive. What proportion o...

A: Attached and free earlobe condition is controlled by autosomal gene with two alleles. F- responsible...

Q: why is it important for germ cells to be haploid?

A: Each species of organism have different sets of chromosomes. So understanding the chromosomes is ess...

Q: What is the morphology of the following cells?       streptococci     diplococci    ...

A: * The morphology of bacterial cells shape are of following types.  Bascillus ( rod shaped) Cocci (s...

Q: Carbon Copy (CC), the first cat produced from aclone, was created from an ovarian cell taken from he...

A: Cloning has been around since the late 1800s, but it wasn't until 1997 that Dolly the sheep was succ...

Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...

A: The coat color of  cat is an X-linked trait. Males are hemizygous (one X chromosome and another Y ch...

Q: is nature an art?

A: Nature can refer to the physical world made up of plants and animals.

Q: 8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of ...

A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using ...

Q: Distrubuting areteries possesses more smooth muscle in tunica externa? yes or no

A: Arteries are constantly under stress. The aorta and pulmonary arteries, which are closest to the hea...

Q: 5. In humans, the alleles for blood type are designated IA (A-type blood), I" (B-type blood) and i (...

A: The ABO blood group is based on the presence of specific antigen on the plasma membrane of RBC and s...

Q: Describe the fluid mosaic model of cell membrane structure.

A: The cell membrane is also called as plasma membrane, it is membrane which is separate interior envir...

Q: Which part of your body is denser than water, therefore, to help you sink in the water? (Check all t...

A: We know that human body will swim to some extent if it is submerged in water. Our body is made up of...

Q: ______cannot diffuse across a lipid bilayer. a. Water molecules c. Ions b. Gases d. Nonpolar molecul...

A: A lipid bilayer surrounds the cells.  

Q: Give your response to the following statement: “Eventually, all species become extinct. So it does n...

A: All the species present in a community interact with each other for resources.    

Q: QUESTION 4 Shown here is a graph illustrating data from the original Pulse-Chase experiment analyzin...

A: The correct answer is- rough ER    

Q: Stem cells: Where and when are they found, in animals and plants? How are they studied? What are s...

A: Stem cells are the type of cells which are capable of developing into specialized type of cells insi...

Q: answer

A: Solution : 65) correct option is a  In Juvenile ecosystem zoocenoses is monophagus.  

Q: During which phase does cytokinesis begin? What cell parts migrate to the poles during prophase? Wha...

A:  Cell division in eukaryotes can be either mitosis or meiosis. Mitosis is an equational division in ...

Q: 17. A 42-year-old man presents to the emergency department with a complaint of increasing shortness ...

A: Shortness of breath happens when your body's ability to breathe does not correspond to your brain's ...

Q: You want to breed an apple tree that produced apples with no seeds, yet keeps the specific apples of...

A: Introduction:- An autopolyploid has an additional set of chromosomes that are identical to the paren...

Q: Imagine you pull away the cover slip and drip 10 drops of deionized water on the young Elodea leaf, ...

A: Plasmolysis can be reversed if the cell is placed in a hypotonic solution. Stomata help keep water i...

Q: Describe the makahiya plant and its reaction to a stimuli. Give two scientific questions you can for...

A: Makahiya (Gymnema sylvestre) is a small, woody plant that belongs to the family Asclepiadaceae. It i...

Q: Construct pedigree charts using the inheritance of hemophilia in figure 92 (page 113). This is X-lin...

A: Pedigree chart is a family tree helps to understand the inheritance of a particular trait or disease...

Q: Explain why we say that photosynthesis feeds most life on Earth.

A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...

Q: ng potential, the following statements is like not true about the figure/illustration below? * DRY D...

A: Solution : correct option is C

Q: Ray-finned fishes & Lobe-finned fishes

A: Ray-finned fish, are one of the two major clades of bony fish (Osteichthyes)  the lobe-finned fish, ...

Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA fr...

A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in ...

Q: А C

A: Morphology: The metacercariae, O. felineus has the similar morphology to those of the liver flukes. ...

Q: A series of experiments shows that oil content in a diploid grain is influenced by four genes (a thr...

A: Introduction :- The phenotype of an organism is the sum of its observable traits. A significant dist...

Q: 1. What is the drug target?

A: Drug is any substance that is used to prevent, diagnose, treat, or relieve symptoms of a disease or ...

Q: Enumerate the functions of spleen

A: The spleen is a lymphatic organ that is part of the body's lymphatic system. The spleen is responsib...

Q: Gould and Lewis make the claim, "Our energy-related social, environmental and public health problems...

A: Renewable energy is the energy from natural resources and it can be regenerated naturally.The major ...

Q: Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the nucl...

A: Answer 

Q: Explain how the three major types of deserts differin their climate and vegetation. Why are desert e...

A: Hi! Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a...

Q: If at least one dominant allele at two different gene loci, A and B are required for normal hearing,...

A: Dominant genes are those genes whose phenotypes are expressed and recessive genes' phenotypes are su...

Q: 1. I. What molecule holds instructions tor the synthesis of proteins and copies itselt tor the next ...

A: Introduction :- Proteins are macromolecules that are polymers of structural units known as amino aci...

Q: 1. Your roommate has noticed that you now spend most of your time studyingmicrobiology and has becom...

A:

Q: Viruses are capable of infecting bacteria by injecting their DNA into the bacterial cells. This was ...

A:     Viruses are capable of infecting bacteria by inserting their DNA into the bacterial cell. This w...

Q: Assessment about - citing the Evidences of Evolution

A: The term evolution is associated with variations that can be found among the groups of living beings...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: Describe the ways that membrane proteins associate with the lipid bilayer.

A: The cell membrane, also known as the plasma membrane, separates the interior of the cell from the ou...

Q: The lipopolysaccharide of Gram-negative bacteria is composed of the following EXCEPT:     Phosphol...

A:     INTRODUCTION         Lipopolysaccharides are mainly present in the cell wall of Gram-  negative ...

Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...

A: The brown fur (BB) color is dominant to black fur (bb) color while pigment production (BB, Bb) is do...

Q: The solid black line represents the backbone of the protein. Functional groups 1 and 2 are [ Select]...

A: Q. The solid black line represents the backbone of the protein. Functional groups 1 and 2 are    • a...

Q: How do we determine the essential amino acid residues?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are m...

Q: What are morphological structures of flatworms?

A: Flatworms are the soft-shell bodied, much flattened acoelomate worms, such as tapeworms, flukes etc....

Q: Adrenergic receptor agonist/s: Monoamine oxidase inhibitors Ephedrine Tamsulosin Neurotransmitter/s ...

A: Adrenergic receptor are cell surface glycoproteins that recognise and selectively bind the catecolam...

Q: Swimmers may not pay attention to hydration as compared to runners. Swimmers do not get dehydrated. ...

A: Given: Swimming is tough exercise during which your body sweats in the water. It is like if you were...

Q: Which of the following season you would observe algal bloom (increased productivities) due to re-cir...

A: Algal bloom : It is an accumulation of algae in freshwater or marine water systems. During algal blo...

Q: Define osmosis and solve simple problems involving osmosis; for example, predict whether cells will ...

A: Osmosis does the following things. Osmosis affects nutrition delivery and the release of metabolic ...