QUESTION 4 Shown here is a graph illustrating data from the original Pulse-Chase experiment analyzing protein secretion in pancreatic acinar cells. Trace B corresponds to radioactivity in which structure? "Chase" 100 A. 20 60 time (min.) "Pulse" (4 min.) O Secretory vesicles O Golgi complex Smooth ER Rough ER Endosomes % of total grains

Q: It is estimated that every human carries at least one recessive lethal allele (i.e. they are heteroz...

A: In diploid organisms such as humans, the efficacy of selection on a deleterious mutation depends bot...

Q: 3. A series of dihybrid test crosses gives the following crossover frequencies of 5genes located on ...

A: Linkage is a phenomenon in which genes are exhibited on the similar chromosome . While , genes that ...

Q: glutamate when it binds to postsynaptic AMPA receptors

A: glutamate is the main excitatory neurotransmitter in the central nervous system, it primarily intera...

Q: egarding the endocrine system, which of the following statements is FALSE? A. Hormone secreted durin...

A: Various physiological systems constitute the human body. There are a total of 12 organ systems in th...

Q: Propagation of action potential and transmission mean:   current flow along the cell membrane   cur...

A: Introduction: The action potential is the name given to the brief series of events that occur in the...

Q: 1. identify and describe the basic structures forming the digestive, respiratory and circulatory sys...

A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...

Q: PHOW does the oxygen binding curve of fetal hemoglobin differ from that of adult hemoglobin

A: Oxygen binding curve for foetal haemoglobin is shifted towards left relative to the curve for adult ...

Q: Discuss the role of the regulator in relation with DNA damage and recombination in the article histo...

A:   Candida glabrata, is species of haploid yeast, it is a nosocomial fungal bloodstream pathogen, thi...

Q: What is genetic disorders? Explain by giving an example.

A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...

Q: Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossoria...

A: Fossorial legs: * These legs are also called as digging legs. *Forelimbs of insect contains  Fossori...

Q: Lactate is usually removed from the muscle cells by a(n) that also transports O antiporter, H* O ant...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: f a patient was experiencing difficulty controlling their movement and displaying motor tremors and ...

A: The nervous system can be described as an organ system associated with the flow of information from ...

Q: Which type of organism (obligate anaerobe, microaerophile, facultative anaerobe, aerotolerant anaero...

A: Introduction :- Obligate anaerobes are organisms that can only survive in oxygen-depleted situations...

Q: Construct pedigree charts using the inheritance of hemophilia in figure 92 (page 113). This is X-lin...

A: Pedigree chart is a family tree helps to understand the inheritance of a particular trait or disease...

Q: In an insect species, the genes for white eyes (w) and smooth legs (s) are linked and are located 16...

A: In genetics, genes forms the hereditary units of life. The genes contains two alternative forms call...

Q: Unlike a rabbit, running all-out for a few moments to escape a predator, migratory birds require ene...

A: Acetyl coenzyme A is a key metabolic intermediate that is produced in a variety of methods, includin...

Q: Please answer fast If the plasmid Lac operon has a mutated lacO operator gene that prevents the rep...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: Comprehensive explanation about how the species of finches , that were found by darwin at galapagos ...

A: Natural selection, according to Charles Darwin's theory of evolution, is how evolution occurs. Physi...

Q: Compare the somatic and autonomic nervous systems

A: somatic nervous system  is  brain and spinal cord both  are responsible for processing or integratin...

Q: Which of the following is the correct passage of the food and water in paramecium? O oral groove-->c...

A: Paramecium is a unicellular, eukaryote protozoan, which lives in the fresh water. It is a slipper sh...

Q: What type of tissue is the heart made out of

A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...

Q: The primary organ that regulates our hunger is? A. The liver B. The stomach C. The brain

A: Hunger is an uncomfortable or painful physical sensation caused by insufficient consumption of dieta...

Q: Hypothesize  as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...

A: INTRODUCTION Iron is an essential element for bacterial growth. Because it's participation in tricar...

Q: What is the purpose of an autoclave and what is its mechanism?

A: Answer :- An autoclave is utilized in clinical and research facility settings to disinfect lab hardw...

Q: Formation and dissolution of clots is primarily regulated by   hemolysis positive feedback negative ...

A: When platelets, proteins, and cells in the blood clump together, a blood clot forms. Your body devel...

Q: Breast feeding confers what type of immunity to an infant? O Artificially acquired active

A: The immune system is the human body's defence mechanism against foreign particles such as bacteria, ...

Q: 8. With respect to hemoglobin, how do you think carbon monoxide can cause hypoxic (low- oxygen) tiss...

A: Carbon monoxide poisoning is a leading cause of accidental death in the United States. It's importan...

Q: 5 Statement of the problem about this topic thank you Title: Effects of organic and special fertili...

A:   Bitter gourds require a very hot and humid climate to grow well. Plant bitter gourd seeds grow in ...

Q: if you were going to move a vesicle or organelle from one place to another within a cell, describe t...

A: If we were going to move a vesicle or organelle from one place to another within a cell,nuclear enve...

Q: Describe the process of bioavailability-bioaccumulation-biomagnification with reference to biogeoche...

A: The biogeochemical cycle is a natural flow of essential chemical elements of living matter between t...

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a pr...

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying e...

Q: What do you call the movement in which the yolk plug is formed in amphibians?

A: Introduction:- The residual patch of endodermal cells generated after the formation of the dorsal li...

Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...

A: The 4 classes of macromolecules are -  carbohydrate  Lipid  Protein  Nucleic acid  Carbohydrate pr...

Q: What ion and ion channels does a muscle cell have?

A: Muscle is a specialized tissue that arises from the mesodermal layer and aids in an organism's movem...

Q: What proportion of the offspring of the following crosses involving independent segregation will be ...

A:  

Q: heart Love carries oxygenated blood from the lungs to the heart LOVU deoxygenated blood from the upp...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: As a rule of thumb, each 1% of soil organic matter by weight contains about 1,000 pounds of nitrogen...

A: Any material created by living organisms (plants or animals) that is returned to the soil and decomp...

Q: Describe the three main types of cell-cell adhesion. • Explain unassisted membrane transport and pro...

A: There are three types of cell-cell adhesion :    1) symmetric homotypic, 2) asymmetric homotypic and...

Q: How will you distinguish b Stem cell from B cell at DNA level

A: B stem cells: it includes pluripotent hematopoietic stem cells that gives rise to multipotent common...

Q: Explain in 2-3 sentence about the advantage and disadvantage of using plastic in your everyday life.

A: Plastics are the synthetic polymers of carbon and other elements with high molecular weight . It is ...

Q: Thesis statement abut bioethtical issue of euthanasia.

A: The primary criteria for euthanasia was in terms of animal welfare. And that are that the method be ...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Please choose all that apply for Phylum Arthropoda. segmentation coelom hemocoel O endoskeleton O op...

A: Introduction:- Animals without a notochord – the rod-like elastic structure that supports the body –...

Q: Explain the main regulator being evaluated in the article histone h4 dosage modulates DNA damage res...

A: Histone H4 is a key protein in the structure and function of chromatin, and its sequence variants an...

Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer

A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a double-stran...

Q: Differentiate between interspecific and intraspecific competition and provide a specific example of ...

A: In nature the resources available tends to be limited at any given point of time. This limited avail...

Q: QUESTION 1 Vaccination increases the number of: different receptors that can recognize a pathogen ep...

A: The term vaccination is associated with the action responsible for stimulating the human body’s acti...

Q: Does the type of diet of the insect affect the structure of organs/parts of the digestive system? Ci...

A: The insect digestive system is a closed one with one long enclosed coiled tube called the alimentary...

Q: In what cellular process does the drug target play a role?

A: Cells are separated from their surroundings by the cell membrane.

Q: In what way does the interior surface of the cell membrane of a resting (non-conducting) neuron diff...

A: The resting membrane potential is a result of different concentration inside and outside the cell . ...