Which of the following can move a substance against the concentration gradient? Select all that apply. O Secondary Active Transport O Osmosis O Simple diffusion O Proton pump O Primary Active Transport O Facilitated diffusion O Exocytosis

Q: This protein adduct can hold (tether) a peripheral membrane protein to the cell membrane: A) A fatty…

A: Ionic linkages peripheral membrane protein or interactions with the polar head regions of the…

Q: Match the viruses with the diseases that they cause: Human Immunodeficiency virus Herpes zoster H1N1…

A: Viruses are the connecting link between the living and the non living. These have some properties of…

Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…

A: The tissues that undergoes stretching without even stimulation is referred as the passive tissue.…

Q: ACTIVITY 12 - LIPIDS As you watch the video, take notes about what you are learning about lipids.…

A: Introduction A lipid is any of several chemical molecules that are water insoluble. They are…

Q: The following images show a pure culture that has been grown on a brewers agar deep, tested for the…

A: Various biochemical tests are performed to differentiate bacteria.

Q: Mitochondria produce which of the following? A. ATP B. DNA C. RNA D. proteins

A: Answer :- Option A correct, Mitochondria which is produce ATP (adenosine tri phosphate)   ATP are…

Q: ORIGIN 1 acacttgctt ctgacacaac cgtgttcact agcaactaca caaacagaca ccatgctgac 61 tgctgaggag aaggctgccg…

A: The gene contains information to code for specific proteins in the form of the nucleotide sequence.…

Q: Calculate how much agarose is needed to make a 3% agarose gel in a volume of 150 ml 1x TAE buffer.

A: Introduction Agarose gel electrophoresis is a type of gel electrophoresis used in biochemistry,…

Q: Explain the monoamine theory for the etiology of major depression.

A: The Monoamine Theory of Mental Depression states that the low levels of norepinephrine and serotonin…

Q: In chymotrypsin the active site histidine Forms a tetrahedral intermediate O a. O b. Acts as a…

A: Serine protease is part of the catalytic triad and consists of the serine, aspartic acid, and…

Q: OBelow is a diagram of two models of protein sorting mechanisms. After analyzing the two models, how…

A: The protein targeting or protein sorting is the biological mechanism by which the proteins are…

Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…

A: The above clinical presentation is a typical of a provisional diagnosis of Iron deficiency anemia.…

Q: Pathogens have a variety of traits that interact with a host and enable the pathogen to enter a…

A: A pathogen is an organism that is capable of causing disease in an organism. It is also known as an…

Q: Why is COVID 19 and getting the vaccinated important, citing from a source?

A: NB:  for your kind knowledge, according to Bartleby rules and regulations we can't mention…

Q: Name the three divisions (parts of the ear).

A: We will answer the first question as exact one question is not specified. Please send back the…

Q: During ejaculation, sperm cells and semen is released from the reproductive tract of a male. What…

A: Ejaculation It is the process through which sperm cells and seminal plasma from the male…

Q: ELEMENTS MACROMOLECULE FUNCTION MONOMER POLYMER EXAMPLE(S) CONTAINED CARBOHYDRATES LIPIDS

A: Carbohydrates supply energy to the body, which is one of their key purposes. Before reaching the…

Q: 8. DNA basic structure: Below, I have drawn a representation of a single strand of DNA. Draw a…

A: The self replicating molecules that are present in the chromosomes and carry genetic information are…

Q: racteristics mparison of Major Taxa Fungi Bacteria Archaeans Protists Plants Animals None of the…

A: The given diagram shows the different characteristics of  taxonomical classification of different…

Q: In the figure to the left, what type of transport is being used to move sodium out of the cell? a.…

A: Please follow step 2 for detailed explanation.

Q: Some materials, such as metal bone pins and plastic heart valves, can be implanted into the body…

A: Introduction Immune system:- It is a complex network of cells, tissues, organs, and the substances…

Q: A patient most likely presents with chronic myeloid leukemia (CML) and you have a fullI blood cell…

A: Chronic myeloid leukemia (CML) is also known as 'chronic myelogenous leukemia', is an uncommon type…

Q: Where on the cladogram would you place the common ancestor of brown algae and water molds? The…

A: A cladogram is a diagram that shows the evolutionary relationships between organisms. It is used to…

Q: Once the antigen presenting cell delivers the message about the identity of the specific pathogen to…

A: In vertebrates, the innate, or nonspecific, immune system is one of two major immunity systems (the…

Q: In chymotrypsin the active site histidine O a. Forms a tetrahedral intermediate O b. Acts as a…

A: Chymotrypsin is present in an inactive form called chymotrypsinogen which is an inactive precursor.…

Q: Which group bears stomata only in the sporophyte generation? Answer A. Bryophyta  B.…

A: Stomata These are defined as the cell structures that are present in the epidermis of leaves and…

Q: Not yet answered Protein X and Y are mixed together. Protein X is 400 residues in size, and…

A: Chromatography It is a laboratory technique through which a mixture is separated into its…

Q: What feature of the skin creates a physical barrier to microbial invasion? Group of answer choices…

A: Introduction:- The covering, or integument, of the body's surface that simultaneously offers…

Q: Invasion step of metastasis is a complex process that involves epithelial cells transitioning into…

A: Epithelial cells are specialised cells that coat the insides of spaces, organs, and blood vessels.…

Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.

A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…

Q: Stream invertebrates that break large pieces of allochthonous DOM into smaller pieces are referred…

A: Introduction Organic matter:- It is anything that contains carbon compounds that were formed by…

Q: What term describes the substance that is bound by an enzyme and converted to product? O a. Coenzyme…

A: Enzymes are biological macromolecular catalysts. Chemical reactions are accelerated by enzymes.…

Q: Which group of bacteria contains the gram-positive, anaerobic bacterium that causes botulism? (a)…

A: Introduction :- Bacteria having thick cell walls are known as Gram-positive bacteria. These…

Q: Drugs that interfere with sympathetic nerve signals are often prescribed for men who have high blood…

A: Nervous system The nervous system of the body is the complex system that controls and coordinates…

Q: A nuclear power plant employee, 20 years old, was entered the hospital with a diagnosis of "acute…

A: Acute radiation sickness is condition which occurs in a person who has been exposed to a high amount…

Q: Question 2 1 pts The nundber and size of organelles in a cell correlates with that cell's function.…

A: Microtubule along with intermediate fillament and microfillament form cell cytoskeleton.…

Q: Pick one scientific conclusion that is put forth in this chapter that is based on both types of…

A: A scientific report typically depicts the results of scientific research in an experiment or either…

Q: Three mechanisms by which membrane-bind-ing proteins bend a membrane are illustrated in…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: Explain how each of the following is a signaling molecule, an effector molecule or an adaptor…

A: Introduction :- Ligands, a broad name for compounds that bind selectively to other molecules, are…

Q: Under which of the following conditions wpuld sexual reproduction advantageous? A. In changing…

A: Sexual reproduction is the type of reproduction that involves the union of two gametes, i.e., the…

Q: In ruminants, what is the function of their gut microbes? O Make vitamin D O Digest cellulose O Move…

A: Cellulose is an organic compound or structural polysaccharide of plants and algae. It provides…

Q: 18. Hershey and Chase used radiolabeled macromolecules to identify the material that contains…

A: Hershey and Chase had done their experiment to find the genetic material. They used different kinds…

Q: Which of the following are involved in photosynthesis in plants and algae? chloroplasts CO2 water

A: Photosynthesis is an important method for inbound living organisms. students and researchers…

Q: Which are true about tick-borne bacterial diseases? Select which true O One example is the West Nile…

A: Examples for tick borne bacterial diseases include Lyme disease, Rocky Mountain Spotted  Fever,etc.…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Hello I'm a food technology student and I have a question about this matter its about this…

A: Food defects means the defects during processing or packaging. Packaging defects also affects the…

Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides

A: The DNA or deoxyribonucleic acid is the genetic element in living organisms that determine the…

Q: of В C

A:

Q: What is NADP and NADPH?

A: Introduction - Plants can create ATP through a similar process during the light reactions of…

Q: Hardy-Weinberg principle

A: Definition: Hardy-Weinberg law of genetic equilibrium is that both gene frequencies and genotype…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.