5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU 3'

Q: How is cystic fibrosis inherited

A: Cystic fibrosis is a disease that affects the lungs and organs of the digestive tract due to…

Q: 1.Why is mitosis also referred to as the equational division? 2. Where does the spindle fibre…

A: There are two type of cell division, mitosis and meiosis. Most  when people talk about "cell…

Q: What is a transitional fossil? Transitional fossils were poorly adapted to their environments. O…

A: Introduction - Any preserved remains, impression, or trace of any once-living thing from a previous…

Q: A male and a female hedgehog escape from separate cages in a pet store. They both have gray…

A: Let,  G - allele for gray bristles and  g - allele for whitish bristles

Q: When a certain body arna manitest an typeromia, increased capilary fitration and sweoling, mis…

A: Introduction Hyperemia is a condition in which there is an excess of blood in the vessels of a body…

Q: The reason due to which the calico cats are always considered as female.

A: Calico cats are cats with white, black, and orange patches on their coats. Calico cats do not obey…

Q: List and describe the 6 stages of phagocytosis.

A: Introduction :- Phagocytosis is a cellular process that involves the ingestion and elimination of…

Q: earth'sis composed primarily of iron and nickel.

A: Our planet Earth is divided into four layers, these areas; inner core  outer core mantle thin-crust…

Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…

A: Introduction :- Fatty acids and lipids are other terms for fats. Three molecules are linked together…

Q: Older adults must consume more calories to stay healthy? A. True B. False

A: It is a false statement that older people need more calories to stay healthy. Although there is no…

Q: Explain the reason why modern biologists can more easily accept that a mammal can have some reptile-…

A: Mammalia is the class of mammals. They are warm-blooded creatures that control the terrestrial…

Q: What are the long term effects of the continued use of the baygon insecticide to the members of the…

A: To explain: To explain the long-term effects of the continued use of the baygon insecticide in…

Q: A. A mutation is recovered in the gene that encodes the lactose operon repressor protein (LacI).…

A: Lac operon is a simple prokaryotic group of genes for the metabolism of lactose. It consists of…

Q: The activity of restriction enzymes may produce fragments with sticky ends.  Sticky ends are   a) a…

A: Correct option is (c). Restriction enzyme, also called as restrictions endonucleases,  is a…

Q: 6. You were asked by your laboratory instructor to prepare the following: 12 plates (use maximum…

A: The nutrient media contains essential nutrients to support the growth of microorganisms. Different…

Q: Which of the following pairs of sequences would be considered different alleles in DNA profiling?…

A: DNA profiling employs highly variable conserved regions known as variable number tandem repeats…

Q: What are the divisions of white light according to the electromagnetic spectrum? Which are the two…

A: The white light is made up of seven colors spread between the wavelength of 400 nm to 780 nm. This…

Q: Why might the GluR-B mutation prevent calcium from moving through the receptor?

A: The physical and functional unit of that generally states that term which define the heredity is the…

Q: A person living in a coma is considered living or dead?

A: Coma is a prolonged stage of sleep caused by a variety of factors such as traumatic brain injury,…

Q: Define the following terms as they apply to Microbial Ecology: a. Fixation b. Production

A: A. Microbial fixation means to transform the complex chemicals to simple absorbable form so that…

Q: Give the meanings for the following conditions: 11. hyponatremia - 12. polydipsia - 13. glycosuria -…

A: Medical biology is a branch of medicine which use laboratory methods (analysis, microscopy,…

Q: Cofactor/domain that moves between active sites in the PDH complex. O TPP O FAD O biotin O lipoamide…

A: The pyruvate dehydrogenase complex connects carbohydrates to the tricarboxylic acid cycle. Pyruvate…

Q: Both cartilaginous and bony fishes have_ a. jaws d. a swim bladder b. a bony skeleton e. a…

A: The name vertebrate comes from the Latin word vertebrae, which refers to the spine's bones. Animals…

Q: 20. The following data are found for the steady state kinetics of a multi- subunit enzyme: [S]…

A: Introduction The study of the rates of enzyme-catalyzed chemical reactions is known as enzyme…

Q: What feature of the skin creates a physical barrier to microbial invasion? Group of answer choices…

A: Introduction:- The covering, or integument, of the body's surface that simultaneously offers…

Q: 7) This refers to the pattern being followed by the arrangement of an animal's body parts. 8) This…

A: The organisms are classified into three categories based on symmetry -  Assymetric Radially…

Q: The FITT principle is? A. The principle that a good physical fitness program should be based on…

A: Exercise is a significant aspect of determining an individual's health. Lack of physical activity…

Q: Sickle cell 1). how many people does it affect? 2) Is it genetic and if so what chromosome is the…

A: Sickle cell disorder :-

Q: state the source of the energy in the food eaten by the ox

A: The ox are used in field for ploughing the fields. The ox are also known as male bullock, they lack…

Q: Order the events leading to the formation of urine in the bladder.   Question 106 options:…

A: Urinary bladder The bladder or urinary bladder is appear shaped triangular hollow organ located…

Q: How does capillary electrophoresis differ from gel electrophoresis?   a) The capillary system can…

A: Gel electrophoresis is done in a vertical or horizontal plane with a polymeric matrix of…

Q: 27 The low pH of the stomach enhances chemical absorption, particularly nutrient absorption True…

A: 28. Most medications from the blood cannot enter the brain because of the blood–brain barrier (BBB).…

Q: Photosynthesis is the most important producer of molecular oxygen (02) on our planet. From which…

A: To explain: To explain about photosynthesis, the molecules involved, and the destination of the…

Q: ABCD Crime Scene DNA Fingerprint 11. What can you conclude about sample A's involvement in the crime…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: China's total annual coal consumption is less than the United States' consumption True False

A: The answer is False.China's total annual coal consumption is more than the United States'…

Q: What is the mechanism for lymphocyte maturation so that lymphocytes will respond to non-self cells…

A: Introduction:- White blood cells, or lymphocytes, are one of the body's main types of immune cells.…

Q: During the seismonastic movement in Mimosa pudica turgor changes occur in- (A) Leaflets (B) Stipules…

A: Introduction - The types of movements and responses that plants display when they are stimulated are…

Q: Discuss the challenges associated with implementing a Real Options Analysis for a Biotechnology firm…

A: Biotechnology is defined as "the application of organisms, cells, components thereof, and molecular…

Q: 3. Although rabbits cannot break cellulose down into simple sugars, the bacteria that live in their…

A: Cellulose is a polysaccharide that consists of several units of beta D glucose units joined…

Q: 5) Peptic and gastric ulcers : Name the organism responsible, what are its adaptations to survive in…

A: Peptic ulcers also known as duodenal ulcers or stomach ulcers.This occurs when open sores form in…

Q: Which of the following scenarios will cause the maternal X chromosome to condense into a Barr body?…

A: The following scenarios will cause the maternal X chromosome to condense into a barr body:. Option 2…

Q: Which of the following statements about type I respiratory failure is correct? CNS depression with…

A: Type 1 respiratory failure or hypoxemic condition is basically when the tissue of lung get damaged…

Q: How are biogeochemical cycles interconnected

A: Introduction :- A biogeochemical cycle (or, more broadly, a matter cycle) is the process through…

Q: Discuss how Genome-wide association studies (GWAS) can be used to identify genetic risk loci for (a)…

A: GWAS helps in screening the genome across the databases to find the desirable results without having…

Q: Tiktaalik and Protarchaeopteryx are examples of transitional forms. In paleontology, what does…

A: Paleontology, usually spelled palaeontology or palaeontology, is the scientific study of life…

Q: Label the visible parts of mung bean and corn seedlings

A: The embryo, endosperm, and seed coat are the three main components of a seed. Before it develops…

Q: Who is responsible for determining the safety andf efficacy of any dietary supplement? A. FDA B.…

A: Introduction Dietary supplements are substances that you can take to enhance your diet or reduce…

Q: to observe the motility of an UNKNOWN Bacteria isolated from a mixed culture, which technique/s is…

A: Motility is the ability of an organism to move from one place to other, generally, the bacteria…

Q: 3. Derive the expression of the electron's charge to mass ratio: e 125R?V 32µ¿N²I?r2 me

A: ANSWER;-

Q: Fats are the primary fuel source utilized in both anaerobic and aerboic exercise? A. True B. False

A: Fats: Fat is a term used in nutrition, biology, and chemistry to describe any ester of fatty acids,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.