estion 8Which of the following is not a characteristic of codon?E yetsweredO a. Codons are adjacent to each other with no gaps in-betweenrked out ofO b. More than one codon for some amino acidsFlagO C. Any codon for one amino acid does not code for any other amino acidestiono d. Codons are sometimes interpreted in doublets (every two nucleotides) when a mutation occur"revious pageF10ScrollLockF5F6F8F9NumLock6.7 78.99R.T.Y.5GHJF.

Name: estion 8Which of the following is not a characteristic of codon?E yet
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: estion 8Which of the following is not a characteristic of codon?E yetsweredO a. Codons are adjacent to each other with no gaps in-betweenrked out ofO b. More than one codon for some amino acidsFlagO C. Any codon for one amino acid does not code for

In this question, we have to explain which statement is not correct about the characteristics of…

Answered: Which of the following is not a…

Science

Biology

Which of the following is not a characteristic of codon?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 20P: Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand...

See similar textbooks

Similar questions

Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
1. If an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true? (Use genetic code to answer the question) A. The other codon is going to have the same two bases as the first and second as the codon described for this amino acid. B. The same sequence as this codon with a purine as the last base is also a codon for this amino acid. C. It has at least two codons. D. The same sequence as this codon with the other pyrimidine as the last base is also a codon for this amino acid. Please answer asap
5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
10. During elongation of a peptide chain, which site in the ribosome represents the location where a codon is being read? a) sigma factor b) large subunit c) A site d) E site e) P site
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8