Answered: Which of the following lipids is NOT…

Which of the following lipids is NOT found in biological membranes? glycolipids phosphoacylglycerols triacylglycerols cholesterol

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter2: Molecules Of Life

Section: Chapter Questions

Problem 13SQ

See similar textbooks

Related questions

Q: Identify Four (4) possibilities in cell culture practices that able affect the quality and yield of…

A: Cell culture It is a method of growing the cells in artificial condition i.e. cells are grown…

Q: 1. Calculate the overall AG°' (reported up to two decimal places) for the net reaction. kJ/mol 2.…

A: In biological systems, a thermodynamically unfavorable reaction with a positive Delta G value is…

Q: water using concurrent exchange, rather

A: Maximum concentration of oxygen in blood as it leaves the Gill capillaries will be 50 mm Hg. Maximum…

Q: 23. The following data describe the cleavage of peptide bonds in small peptides by the enzyme…

A: Introduction: Serine proteases are a large group of enzymes that cleaves the amide bond and…

Q: Which among the following statements is correct? O lon-exchange chromatography is dependent on the…

A: Introduction: Chromatography is an analytical technique for the separation of different dissolved…

Q: Calculate the number of phosphates, deoxyribose and ribose, and nitrogenous bases needed for a:…

A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) DNA carries…

Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…

A: Glycolysis is a major metabolic pathway in the breakdown of carbohydrates such as glucose.…

Q: 4. As stated in your textbook, the first two reactions in glycolysis associated with unfavorable AG"…

A: The 2 reactions of concern here are the 6th and 9th reactions of glycolysis. Both these reactions…

Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…

A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…

Q: The laboratory requests of the physician are Glycosylated Hemoglobin and Serum Glucose for Mr. John…

A: Introduction: Glycosylated hemoglobin is a form of hemoglobin that is measured primarily to monitor…

Q: Roam around your kitchen and collect some items that you can categorize as sources of each…

A: Carbohydrates are one of the important nutrient. Its major functions as a energy source, and also…

Q: Why egg whites and milks are used as antidotes for heavy metal poisoning?

A: Heavy metal poisoning is a process in which an organism is exposed to excessive amount of heavy…

Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…

A: Two answers are correct

Q: Why is DNA not RNA the storage for genetic information?

A: DNA : Deoxyribonucleic acid is a genetic material for the storage of information. The structure of…

Q: As observed in the LipidBank database, the lipopolysaccharide referred to as Lipid A from…

A: The cell of a gram positive bacterium is composed of cytoplasm, plasma membrane, cell wall, and a…

Q: Step by Step process of Embden-Meyerhof pathway of RBC metabolism Pls Explain as simple as…

Q: n circulatory system, one the main function of our blood is controlling our body temperature.…

A: Blood is one of the connective tissues that absorbs and distributes heat throughout the body.

Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…

A: In our body, many metabolic pathways occur. In these pathways, Glycolysis also occurs to convert…

Q: Question 8 Which of the following IS a Phase Il metabolic reaction? O Fornation of a ketone at a…

A: Question 8 ans: Phase l metabolism is when a parent drug is converted to polar active mrtabolite…

Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…

A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…

Q: The 6-member pyranose ring of glucose is formed through the interaction of the hydroxyl group on C5…

A: The carbohydrate glucose can form an intramolecular cyclic hemiacetal.

Q: In a reverse phase chromatography set up, the component that yields the lowest Rf value is likely to…

A: Reverse phase chromatography: The chromatographic technique that uses the hydrophobic stationary…

Q: Enzyme: Crystal Structure of Wild-Type Human Phosphoglucomutase-1 (PGM1) the description of the…

A: The enzyme PGM1 is very well known for its central role in specific human metabolism, where it…

Q: I'm working on the thermodynamics of protein binding but I want to understand more on the enthalpic…

A: Introduction Protein folding and protein-ligand interaction are basically thermodynamically driven…

Q: Enzymes accelerate the rate of a reaction by: a. lowering the number of molecules with lower…

A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…

Q: Hypothesize ways to manage the disorders associated with the Inborn Errors of the Krebs Cycle. Given…

A: In the TCA cycle net gain of 6NADH molecule, 2FADH2 molecules by oxidative phosphorylation,…

Q: What are the control mechanisms of glycolysis and the Krebs cycle.

A: The question is all about the process involve in respiration like glycolysis and kreb cycle in which…

Q: All of the following elements are involved in the signaling cascade that promotes glycogen breakdown…

A: INTRODUCTION- Glycogen is the major storage form of glucose mainly in the liver and muscle, glycogen…

Q: Sample pH vs Initial Velocity (AA450/60 seconds) a bo16 0.0014 al0012 0.0008 0.0006 0.0004 0.0002 pH…

A: Enzymes are biological catalysts that are capable of catalysing a reaction by binding to Substrate.…

Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…

A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…

Q: How many molecules of ATP are generated by the complete mitochondrial beta oxidation of the…

A: Nervonic acid is a 24 carbon fatty acid with a double bond between the 15th and 16th carbon atom…

Q: RNA Pol III transcribes the following class of RNAS TRNAS rRNAs small nuclear RNAS All of the above

A: RNA pol III :- eukaryotic RNA polymerase, help in eukaryotic transcription.

Q: What are two functions of the hepatic portal system?

A: In the animal's circulatory system, there is presence of a portal venous system. This occurs when…

Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…

A: The RBCs are the cells which carry oxygen to various tissues. The RBCs yield energy from the…

Q: Which among the following correctly represents the characteristics of an anion exchanger O Anion…

A: Ion exchange chromatography a chromatographic method based on the net charge of the protein.

Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.

A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…

Q: 7. Which of the following is an example for a ribozyme? a. transpeptidase b. glutamyl transpeptidase…

A: Introduction: Ribozymes are ribonucleic acid enzyme that is capable of catalyzing specific…

Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…

A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…

Q: Introduction to campylobacter spp.

A: Bacteria are a key component of cellular life on Earth, and they may be found anywhere from the tops…

Q: • What happens to the functionality of a denatured enzyme? • How can that result be explained with…

A: Enzymes are biological machines that may catalyze certain processes in the cell. Enzymes catalyze…

Q: Which among the following The colored solution formed as a positive result for the Biuret test is…

A: A polypeptide chain has amino acids linked together by a peptide backbone.

Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…

A: Aminoacids are the building blocks of proteins that are classified as acidic , basic and Amino acids…

Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…

A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…

Q: Coenzyme Q-10 (Ubiquinone) is one of the most important and crucial substances within the human…

A: Introduction: Coenzyme Q-10 is also known as ubiquinone or coenzyme Q. It is an oil-soluble and…

Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…

A: Chromatography is an analytical technique for separating components of a mixture

Q: Discuss models for how amyloid fibrils form from unfolded or misfolded proteins and for how the cell…

A: Misfolded proteins result in many degenerative diseases and this often occurs due to several…

Q: Which of the following genes have internal promoter elements? 5S FRNA MRNA snRNA None of the above

A: Promoter : the sequence that are important in the initiation of transcription of a transcription…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: Briefly describe the following and give examples. 1. Starch 2. Glycogen 3. Protein

A: There are four classes of biological macromolecules: nucleic acids, lipids, proteins and…

Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…

A: The TCA cycle or tricarboxylic acid cycle is the second stage of cellular respiration. This is a…

Question

Which of the following lipids is NOT found in biological membranes?

		glycolipids
		phosphoacylglycerols
		triacylglycerols
		cholesterol

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Glycolipids

Phospholipids

Cholesterol

Triacylglycerols

Answer

Trending now

This is a popular solution!

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Unlike saturated fatty acids, the tails of unsaturated fatty acids incorporate one or more _______. a. phosphate groups b. glycerols c. double bonds d. single bonds
All of the following except ________ are building blocks or energy sources in cells. a. fatty acids b. simple sugars c. lipids d. amino acids e. nucleotides
Cell membranes consist mainly of ________ and ________. a. lipids; carbohydrates b. phospholipids; proteins c. lipids; carbohydrates d. phospholipids; ECM
Saturated fatty acids are so named because they are saturated with (a) hydrogen (b) water (c) hydroxyl groups (d) glycerol (e) double bonds
Which of the following is the carbohydrate, the fatty acid, the amino acid, and the polypeptide? a. +NH3CHRCOO b. C6H12O6 c. (glycine)20 d. CH3(CH2)16COOH
An example of a monosaccharide is ________. a. fructose b. glucose c. galactose d. all of the above
Unlike saturated fats, the fatty acid tails of unsaturated fats incorporate one or more ________. a. phosphate group c. double bonds b. glycerols d. single bonds
What kinds of bonds often control the shape (or tertiary form) of large molecules such as proteins? a. hydrogen b. ionic c. covalent d. inert e. single
Steroids are among the lipids with no _________. a. double bonds b. fatty acid tails c. hydrogens d. carbons
Cellulose and starch are examples of______. a. monosaccharides b. disaccharides c. lipids d. polysaccharides
The mutual attraction of opposite charges holds atoms together as molecules in a(n) _____ bond. a. ionic b. hydrogen c. polar covalent d. nonpolar covalent
Which of the following lipid types is NOT found in biological membranes? Glycerophospholipids. Cholesterol. Triacylglycerols. Sphingolipids. Gangliosides.