Use the figure below to answer the following questions.T16172CRSRSL1T16126CIA161296IC16264TIT16270CIA162936G16230AC161481A161666C1629411C16360T(163111G16390AG16048AT16244T163620A161296T16187CI(161891G16129A1T161890116249T163110T16278T16298C16327TM1163620C16260TT16325CC16311TC162901G16319AT163110IG16129A!A16241GG16213A116189C162781C16292TNT16231CG16129A!G16391A116189CT16304CC16176TT162230I-R-T16126CC16069TC162941C16067TT16298CC16270TT16172CIT16189CIA16219GUT16249CA16051G1G16129IT16189CA16243GT16356CA16318TT163110T16224CILia L1b Lic L5 L2 L6 L4 L3 M1 CZ D G QA OSX WIY BFPJT HVVH U6 US U1 U2 U3 U4 U7 KFigure 1.3. mtDNA lineages. This map indicates existing mutations for each haplogroup as we move down the tree from the starting point at "RSRS."This map listsall mutations in the hypervariable region, which can help identify DNA having these mutations as belonging to a certain haplogroup. (Illustration by Ty Inhofor). Which of the following mutations is only found in Haplogroup F?O T16223CO G16230AO T16304CO A16129GO C16311TQuestion 40Based on the phylogenetic tree above, which of the following haplogroups evolved first?OVORO AONU

Any kind of change or alteration in the order of DNA nucleotides is called a mutation. Mutations are…

Which of the following mutations is only found in Haplogroup F? OT16223C O G16230A O T16304C O A16129G O C16311T Question 40 Based on the phylogenetic tree above, which of the following haplogroups evolved first? OV OR O A ON O U

Which of the following mutations is only found in Haplogroup F? OT16223C O G16230A O T16304C O A16129G O C16311T Question 40 Based on the phylogenetic tree above, which of the following haplogroups evolved first? OV OR O A ON O U

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter16: Adult And Pediatric Dosages Based On Body Surface Area

Section: Chapter Questions

Problem 16SST

See similar textbooks

Related questions

Q: 8. frame shift mechanism contributes to the following a. Somatic hypermutation b. class switching -…

A: 8. C.Gene conversation Frame shift mutation mainly occurred through the process replication. This…

Q: Label the following graph, which indicates the temperature versus the percent of DNA that is single…

A: DNA The genetic material of organisms reside in the nucleus of the cell. It carry genetic…

Q: If you wanted the most variable litter possible, what colors of Labrador retrievers would you cross?

A: Labrador retrievers are the most friendly dogs. They are good companions and working breeds.…

Q: short description about the specimen of humam cheek cells (animal cells)

A: Q. Short description about the specimen of humam cheek cells (animal cells)

Q: Based on your experience in the histology lab, examine the image below and identify the correct…

A: Respiration is a process by which oxygen found the lungs is carried by the blood to the tissues and…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: Transcription The process of formation of RNA from DNA with the help of RNA polymerase.

Q: 21. The following is correct about superantigens? A. cause autoimmune disease C. activates B cells…

A: Introduction :- Superantigens (SAgs) are a group of antigens that cause the immune system to become…

Q: Describe the structure of DNA, using appropriate terminology.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: What would be the effect of crossing-over between two sister chromatids?

A: A chromosome has one chromatid before DNA replication.

Q: 16. Expression of CD25 and CTLA-4 is a characteristic of? A. TH1 B. TH2 Treg

A: CD25 is a protein marker for CD4+ thymocytes. It hs actually the α-chain of the IL-2 receptor. CTLA4…

Q: For table 3 which molecules were able to move through the membrane and which were not?how do you…

A: Starch is a white substance that found in food like potato.

Q: What is the purpose of a legend? It provides the publisher and other relevant contributors to the…

A: Maps provide a diagrammatic representation of different geographic areas and allow us to obtain…

Q: 2. Which of the of the three compounds lead directly to life? (a) DNA RNA Protein (Ⓒ) Ans:

A: DNA a self-replicating material that is present in nearly all living organisms as the main…

Q: List five proteins of the myofilaments

A: Muscle cell The cell membrane of the muscle fiber/cell is known as sarcolemma. Muscle fibers are…

Q: You would like to amplify the gene shown below using PCR with two primers: the primers are shown on…

A: Explanation: A specific area of DNA is amplified using PCR. Primers, which are compact fragments of…

Q: Do you think society in the period of Darwin's theory of evolution was different from society in the…

A: Modern life has been radically altered by science and science-based technologies. Significant…

Q: resident normal microflora normally colonize internal area of the urogenital system besides skin and…

A: Internal tissues, such as blood, brain, and muscle, are normally free of microorganisms in a healthy…

Q: For the pedigree shown here, the disorder is caused by a recessive (g) allele on the X chromosome.…

A: Introduction Pedigree Analysis: this is the new approach to study the inheritance pattern in the…

Q: How does genetic drift influence natural selection?

A: Introduction :- Genetic drift is the term used to describe the random changes in gene variant…

Q: How are polyribosomes different in prokaryotes and eukaryotes? In eukaryotes they can form right up…

A: DNA The genetic material which is made up of two long chain of nucleotides which runs in opposite…

Q: Why does penicillin purification use a centrifugal extractor?

A: A Centrifugal extractor is a piece of laboratory equipment that uses rotors to mix two immiscible…

Q: What is the possible condition suspected if a 12months baby boy weight is 15kg

A: As we know For a full-term baby, the ideal range of body weight is between 2.5 to 4.5 kgs in it.…

Q: Mendel's law of independent assortment applies to both unlinked and linked loci. True False

A: Mendel's Law of Independent assortment states that the segregation of one pair of allele is…

Q: Photophosphoryation and the Calvin Cycle Q2.2- What happens to the net glyceraldehyde-3P produced by…

A: Introduction: A series of chemical processes that take place as a byproduct of photosynthesis and…

Q: 1.If the systemic blood mass of a person is 2.8 kg, what is the body mass of the person? a.) 200 kg…

A: Given: Systemic mass =2.8 kg The systemic mass and blood mass are related by : Systemic mass =…

Q: Worksheet: What Darwin Never Knew Darwin was a naturalist, or a collector of plants and animals from…

A: Charles Darwin is commonly regarded as the father of evolution. During his young age, Darwin set out…

Q: What is Mitochondria?

A: Mitochondria is called as the “powerhouse of the cell”. The word mitochondrion is derived from Greek…

Q: True or false asap thanks

A: We know that The branch of science that deals with the study of endocrine glands and their…

Q: Q1: Which two children in this pedigree have cystic ﬁbrosis? How do you know? Q2: Does either parent…

A: Cystic fibrosis is an autosomal recessive disorder.

Q: Unique answer asap

A: We know that The nervous system consists of two kinds of special cells: neurons and glial cells. The…

Q: We’re back at it, more fun phytocannabinoids! We want to add Cannabidiol (CBD) to 15 mL of HL-60…

A: Introduction Cannabinoids are any chemical substances that act on the cannabinoid receptors of the…

Q: erforms a function that scientists do not yet understand O b. Prevents energy loss from the brain's…

A: Neurons are the smallest punctual unit of the nervous system. When the neurons are covered by myelin…

Q: Epulopiscium fishelsoni is the largest known bacterium, first discovered by Lev Fishelson, then Linn…

A: Given Bacterium length = 600um or 6 × 10-4 m Bacterium diameter = 80um or 8 ×10-5 m Radius = D/2 =…

Q: Explain the fate of electrons that are removed during the oxidation of triose phosphates during the…

A: Cellular respiration is the process in which the glucose is converted into energy. It includes three…

Q: prpc is a normal protein of our neuronal cell membrane that is sensitive to protease action (ie can…

A: The proteases are the protein degrading enzymes. Once the role of proteinaceous enzymes and…

Q: I just need enlightenment at where exactly did I go wrong or lack in this cladogram. There is no…

A: The animal kingdom is considered one of the largest kingdoms including all the animals. The animals…

Q: RNA World Hypothesis? A RNA are molecular machines that keep cells alive B RNA can form the…

A: Introduction : According to the hypothesis known as the "RNA world," a world with life based on…

Q: There are three major classes of protein make up the cytoskeleton of a typical animal cell. What ar…

A: Given: Equation: N = N0 x 2tG where, N0 = number of cells at zero time i.e. 1 cell G =…

Q: Review a human karyotype to identify the sex chromosomes and any abnormalities in chromosome number.

A: Introduction Cytology refers to the study of cells such as cell morphology, physiology, etc. As we…

Q: Which class of amino acid will you most likely find in abundance in the center of a globular…

A: Introduction Amino acids are the monomer units that result in the formation of proteins. Life's…

Q: 13 0 h D n d r 1 1 Pruc h のn e g 9 1 r e 22p 1 a n + C 21pe и ис r 0 15c 18 to Pl C + h 19cel r S 24…

A: Endoplasmic Reticulum: The endoplasmic reticulum (ER), which also performs numerous other critical…

Q: Please match the type of glomerulonephritis in Column A with their anatomical/morphological changes…

A: Glomerulonephritis is inflammation of the glomeruli, which are structures in the kidneys that are…

Q: Breifly explain how a chloroplast structural protein is built, modified, and transported to the…

A: Most nuclear-encoded chloroplast proteins are synthesized on cytosolic ribosomes as larger…

Q: lan Learnin Both green algae and blue-green cyanobacteria. are filamentous photosynthetic organisms.…

A: Green algae are unicellular/multicellular/colonial photosynthetic organisms that commonly are known…

Q: A) 43 14 When Friend erythroleukemic cells are incubated with sodium butyrate, they differentiate…

A: Introduction : Histones are highly alkaline proteins. They are found in the nucleus of the…

Q: You are working with different tissues in lab, unfortunately you forgot to label them and your…

A: The aim of a microscope is to produce high-quality, magnified images of things that are difficult to…

Q: You are given the task of determining the approximate % solute of potato cells. You decide to set up…

A: The movement of water or solute molecules across a semipermeable membrane is referred to as osmosis.…

Q: If the concentration of a plasma carrier was diminished, what would this do to the half-life of a…

A: Introduction:- There are different types of molecules and chemicals including hormones which are…

Q: III. Identify the numbered parts of a typical plant cell. 1. 2. 3. 4. 11. 10. 5. COFE 9. 8. 6. 7.

A: Peroxisomes Peroxisomes are also called as microbodies. They are about the size of lysosomes and…

Q: 5. Measuring with a ruler using the metric system. The image below shows examples of blood that has…

A: Keeping with the site regulations and in order to provide a good quality answer, Q5 about hematocrit…

Concept explainers

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introdiction

VIEW

Step 2 Final answer

VIEW

Step 3 Explanation

VIEW

Step 4 Explanation for incorrect choices

VIEW

Step by step

Solved in 4 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Go to the NCBI’s website at https://ncbi.nlm.nih.gov On the database dropdown menu, select “Gene” and search for “RB1.” The first entry should be on the Homo sapiens version; click the gene name. Use the information to answer the following: What is the chromosomal location of RB1? Scroll down to the “Expression” data. List 2-3 examples of normal tissues that typically express the RB1 gene. Would you say that RB1 expression is very specific or general within tissues? Scroll down to the “NCBI Reference Sequences (RefSeq)” section. Click on the “GenBank” link under NG_009009.1 RefSeqGene. This will take you to the genomic sequence of RB1. How many nucleotides long is the full-length RB1 gene? Return to the RefSeq section in the Gene Database for RB1 (back click once from where you were for part c). Click on the link under “mRNA and Protein(s)” listed as NM_000321.3. This will take you to the mature mRNA sequence data: How many bases long is the full-length RB1 mRNA transcript? Scroll…
Provide a short answer for each of the questions below. For individuals homozygous for the Duffy gene mutation, which increases resistance to malaria, answer the following questions: 1)What impact do you expect the GATA → GACA mutation will have on the level of Duffy protein expression in red blood cells? 2)What impact do you expect the GATA → GACA mutation will have on the level of Duffy protein expression in endothelial and Purkinje (brain) cells? 3)Explain how this mutation leads to the level of Duffy expression you expect in the different cell types.
Which, if any, of the following statements is incorrect?a) Each person makes many millions of different HLA proteins so as to be able to recognize and bind foreign antigens.b) Classical HLA proteins are highly polymorphic; non-classical HLA proteins show very limited polymorphism.c) Classical class I HLA proteins are displayed on the surface of very few cell types, notably immune system cells.d) HLA proteins are the most polymorphic human proteins.
HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
What is this survival signal?
Which of the following statements describing the mid-blastula transition is CORRECT? a. Cells increase expression of E-cadherin to enhance cell stability. b. Cell division increases to create the germ layers. c. Zygotic genes are activated by demethylation. d. Maternal and zygotic mRNAs provide proteins required prior to the MBT.
Give only typing answer with explanation and conclusion A healthy asymptomatic 27 year old female, Susan, presents to your clinic with known family history of Spastic Paraplegia 4 caused by pathogenic SPAST mutation identified in her mother. She wants to know the risk that she will develop symptoms eventually based on this information. the penetrance of SPAST mutation is approximately 85% for women and 96% for men.
Give typing answer with explanation and conclusion Which antigen was returned to the 901 series because there was no determined linkage to the SMIM1 gene?
A young child with cretinism is not growing and her parents would like her to take synthetic hGH. Will this treatment help the child? Explain your answer
Sickle-cell disease (often called sickle-cell anemia) is a disease that is caused by a mutation to the gene that is responsible for producing the protein hemoglobin. Remember that hemoglobin is a protein in the red blood cells which is responsible for carrying oxygen throughout the body. When a person possesses the mutated hemoglobin allele, their red blood cells take on an altered shape and this results in a variety of symptoms ranging from general weakening of the body, damage to the organs and even death. The sickle cell allele is recessive to the healthy allele, thus only individuals that are homozygous for the recessive allele will have sickle-cell disease. Individuals that are homozygous for the healthy allele, along with heterozygous, individuals will be physically healthy. Question: Given that this mutated allele will cause disease and death in individuals, what would you predict to occur to the frequency of this allele in the population? Explain.
Which are the two generalizations can be illustrated by CCK?
Define the following terms: a. cell transformation b. oncogene c. apoptosis d. early response gene e. delayed response gene