Which of the following statements about carbohydrates intake is TRUE? A. The whole grain bread has higher glycemic index number than the enriched bread B. The AMDR for carbohydrates is lower than proteins but higher than fats C. Orange juice contains more added sugar and less soluble fibers than the actual fruit D. Glycogen in animal meat is the better carbohydrate source than starch in plants

Q: discuss comprehensively Distinguish between simple and complex carbohydrates.

A: Carbohydrates are the rich energy source synthesized in the process of photosynthesis. Carbohydrates...

Q: 4. An X-linked dominant trait with an unaffected mother and an affected father.

A: X linked dominant  This type of Inheritance refers to the mutations in the genes that are present on...

Q: Answer the following about Corynebacterium diphtheria... Oxygen requirement: Is it classified as an...

A: Corynebacterium diphtheriae is a pathogenic organism that causes an infectious disease called dipthe...

Q: .GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will ...

A: A missense mutation occurs when a single base pair is changed, causing a different amino acid to be ...

Q: How are CFU (colony forming units) calculated in urine? (Hint/comment: what is the volume in urine ...

A: Answer 

Q: 13. A peripheral membrane protein is best described as a protein a. embedded within the phospholipid...

A: INTRODUCTION Answers of question 13-15 is given below.

Q: Which of the following is NOT recommended to avoid a sugar rush? A. Increase protein and fat while k...

A: Sugar rush is an experience  of high energy after eating or drinking a considerable amount of sugar ...

Q: [ Select] are to water transport, as [ Select ] are to nutrient [ Select 1

A: Xylem is for water transport. Xylem is the tissue that is involved in transport of water and dissolv...

Q: Both ocelli and statocysts are composed in part of nerve tissue. True False

A: Answer : Both ocelli and statocysts are composed in part of nerve tissue.  false.  

Q: Describe cyclic and non cyclic photo phosphorylation.

A: Photosynthesis is a metabolic process in which carbon dioxide react with water , sunlight and Chloro...

Q: What do their resources tell you about the types of people that do science?

A:

Q: 1. an organism changing during its life to be better suited for its environment

A:     Answer - An organism changing during its life to be better suited for its environment.

Q: 1. IDENTIFY THE EPITHELIUM. 2. WHAT STRUCTURE IS LINED? 3. IDENTIFY THE ORGAN.

A:   1. 

Q: Each time a new tRNA is added to the A site, it adds its amino acid to the bottom of the growing cha...

A:  The description in the question is related to Protein synthesis or translation process which occurs...

Q: EPITHELIUM IN NO

A: Epithelium is refers to layers of cells that line hollow organs and glands. 

Q: What kind of medicine is used to treat ringworm. Is this medicine synthetic or was it isolated from ...

A: Given: Ringworm is caused by the fungus that eats keratin. These are called dermatophytes. They atta...

Q: A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following sequ...

A: Transcription is a process of copying a piece of DNA into RNA. 

Q: _________3. It is microbial organisms that has a gene that makes plants resistant to  herbicides. A...

A: Introduction Herbicides are crop-protecting agents that are used to kill weeds or disrupt normal pla...

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino ...

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.  Intro...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: DDE vs Eggshell Thickness 1.28 1.24 1.2 1.16 - 1.12 3 7 9 11 DDE concentration in egg (ng/g) Shell t...

A: Q-1): In birds, the process of bone remodelling plays a vital role in maintaining bone calcium level...

Q: Microtubules and microfilaments are similar in that: Group of answer choices A. both use GTP as the...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: 1. IDENTIFY THE LINING. 2. IDENTIFY THE ORGAN. 3. IDENTIFY THE SPECIAL STRUCTURE.

A: This diagram is of the mucus layer, which we can clearly identify as we can see in the image 3 layer...

Q: It all about flowering plants-use for asexual and sexual reproduction example Please help it is due ...

A: Sexual maturity is the age in which the reproductive organs mature and mating occurs. In context of ...

Q: What is a primate and why do anthropologists consider it important to study them? What features do p...

A: Primates is belong to those groups of animals, thats under included humans, monkeys and animals like...

Q: health benefits and trvias of table tennis

A: Answer 

Q: Biologists produced the karyotype of a different parrot in Africa that had 2n = 62. Using the inform...

A: A typical African parrot has a karyotype containing 2n = 62-64 chromosomes with 8 pairs of macrochro...

Q: The following monomer and polymer is matched: O DNA - Nucleic acid Protein - Enzyme

A: An atom is the smallest component unit of matter that makes up a chemical element. A molecule is a p...

Q: ). Observe the graph on the right. If you hac a hypothetical plant that only had a hypothetical phot...

A: Yellow light would produce the highest rate of photosynthesis. This is because it is the light at wh...

Q: can you explain me this slides how  to identify and labeled them

A: ANSWER;- The picture is the slide to identify and label them;-

Q: Explain and draw Haploid and diploid and heterokaryotic lifecycle of fungi.

A: Life Cycle of Fungi : Fungi life cycle involve formation of haploid spores and their germination to ...

Q: After a long excursion in the tropics you came back  with multiple soil samples from different local...

A: ISOLATION OF ANTIBIOTIC PRODUCING FUNGI FROM DIFFERENT SOIL SAMPLE:  1.COLLECTION OF SAMLPLE:  soil ...

Q: Describe the absorption of light in your own words.

A: Plants use pigments to facilitate the conversion of light energy into chemical energy. The chloropla...

Q: Peripheral nervous system (PNS) consists of nerves that lie outside the brain and spinal cord which ...

A: The human nervous system is divided into 1) central nervous system (CNS)                    2) perip...

Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using polyadenylat...

A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in euka...

Q: What factor(s) may have influenced the decrease in the number of deaths from cholera up until the ti...

A: * Terrible outbreak of cholera took place in braod Street of london. *  John snow is anesthesiologis...

Q: - What is a pure culture? - Describe the procedure for making a streak plate from a clinical specime...

A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...

Q: Methods of Bioremediation does not include Select one: a. Bioaugmentation b. Phytoremediation c. Bio...

A: Bioremediation: Bioremediation is a field of biotechnology that involves the removal of contaminants...

Q: With what region of the promoter does the the principal interaction between it and the RNA polymeras...

A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: The...

Q: communication. Communication between two plant cells • Communication between two immune-system cells...

A: A..  Communication between two plant cell is cell to cell combination, with help of plasmodesmata B....

Q: • 1. Identify the tissue. • 2. Identify the structures pointed by letter "A." • 3. Identify the stru...

A: The group of cells which function together and have same structure are called as tissues.

Q: Explain in detail difference between homothalism and heterothalism

A: Aspergillus species are homothallic fungi, while Saccharomyces cerevisiae, Aspergillus fumigatus, As...

Q: Which of the following is an accurate model and description of anaphase II in Cape parrots?

A: As per the Karyotype of the somatic cells from the cape parrots obtained, they have total 29 pair of...

Q: Who's is the father of cell biology? And give a little history about him

A: Cell is present in all organism and is a chief elemental unit of the body which is site for various ...

Q: What process begins endosperm formation? How is the endosperm important to plants?

A: Formation of endosperm and its importance to plants: The endosperm is formed during the double ferti...

Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...

A: In a cross, the arrangement of linked alleles on the chromosomes is critical for determining the out...

Q: The teacher suggested that the students revise their model to represent individuals who have a heter...

A: The case in which two different alleles can be observed to be associated with a particular gene is r...

Q: In dogs, dark coat color is dominant over albino, andshort hair is dominant over long hair. Assume t...

A: Hereditary qualities is the study of genes and heredity of how certain characteristics or attributes...

Q: Which of the following is the correct pairing of phenotype and genotype of Individual 5 in the pedig...

A: ANSWER;- A)Dwarf, Homozygous dominant Explain;- A cross between two homozygous assortments generally...

Q: B. Make a punnet square for the following and give the phenotypic and genotypic ratio: 1. One homozy...

A: Answer 1-  the cross between :  GG x gg     G g G GG Gg g Gg gg   The phenotypic ratio of ...