Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: GCA UGC CGA UAC

A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC

Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…

A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: Below is a sequence of DNA.…

A: The process of identifying the coding region and the position of a gene in a genome is known as gene…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction  A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST…

A: a. The codon has a property which is known as degeneracy of the codon .This means that the codons…

Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…

A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…

Q: A small section of a gene for a protein has the following nucleotide sequence: CTG GGA TCC TAA GGT…

A: A nonsense mutation is one in which the mutation induces the formation of a stop codon which leads…

Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…

A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…

A: Central dogma of molecular biology:   It states that the DNA which contains the genes are…

Q: A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate –…

A: In Central dogma, DNA is converted into RNA through the process of transcription and RNA is…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.…

A:

Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW  Why Phosphate bond is important in DNA or RNA…

A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…

Q: Although ultimately coding for all aspects of a protein, the gene codes directly only for what level…

A: DNA is made up of many nucleotides. Each nucleotide is made up of phosphate , a pentose sugar, and…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…

A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…

Q: The sequence of a polypeptide is determined by the order of codons that specify the amino acids in…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: What is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons…

A: Triplets of nucleotides are called codons which specifies individual amino aids in a polypeptide.…

Q: Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please explain…

A: The condition represented in the sequence alignment is amino acid replacement. In amino-acid…

Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide…

A: Point mutation It refers to the mutation in which the single-nucleotide of the sequence of DNA…

Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…

A: Note - We answer one question at a time. The set of rules through which information in the DNA or…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction:  Mutations are changes in the genetic material or character of an organism. It can…

Q: Below is a sequence of DNA.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: From the given DNA base sequence indicated below:…

A: The process by which the information contained in the DNA is converted to RNA is referred to as…

Q: You sequence a new tRNA and discover that the anticodon sequence is 5'-IGC-3. What amino acid does…

A: I corresponds to an unusual bas hypoxanthine, which is found in tRNA

Q: A polypeptide has 51 amino acids in its primary structure. (i)  What is the minimum number of DNA…

A: Protein or polypeptides are the polymers of amino acids and these amino acids are synthesized by…

Q: T-A-C |А - А - G А - т-G G-G-G А -т-т DNA enter answer - enter answer enter answer - enter answer…

A: DNA mRNA TAC AUG AAG UUC ATG UAC GGG CCC ATT UAA

Q: What is the complementary DNA sequence to the following DNA sequence?   ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure?…

A: A single-stranded nucleotide sequence followed by its reverse complement at the downstream is called…

Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…

A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the…

A: The genetic code is the set of rules used for translation of the information encoded within genetic…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

A:

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   What human disease has been connected to this gene?…

A: The given sequence  CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…

Q: Line A below shows the peptide synthesized after transcription and translation of a piece of DNA.…

A: Any detectable, inheritable qualitative or quantitative changes in the genetic material of an…

Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…

A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.