A common strategy for identifying distantly relatedhomologous proteins is to search the database using a shortsignature sequence indicative of the particular proteinfunction. Why is it better to search with a short sequencethan with a long sequence? Do you not have more chancesfor a “hit” in the database with a long sequence?

A common strategy for identifying distantly relatedhomologous proteins is to search the database using a shortsignature sequence indicative of the particular proteinfunction. Why is it better to search with a short sequencethan with a long sequence? Do you not have more chancesfor a “hit” in the database with a long sequence?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Why is it that sometimes you can identify some sequence similarity for protein sequences (i.e., BLASTp) but not for the corresponding DNA sequences (i.e., BLASTn)?
Which of the sequences below do you think would most likely be found in an intrinsically disordered protein? GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA All of these could be found in an intrinsically disordered protein
Suppose you performed two BLAST searches, one on the peptide sequenceFIDPWE and another on the sequence KRTIAAVNSPLLEVATY. Whichsearch do you predict will give you alignments with “expect scores” closerto one? Explain your reasoning.
Which of these amino acid sequences will most likely favor the formation of a b-pleated sheet secondary structure?
Describe the planar sections of the primary sequence, their influence on the shape of the protein backbone, and identify these sections given a drawing of the primary sequence.
Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein sequences Q4VW83 and Q4VW8
What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)
If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?
Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?
The earlier that two genes arose from a duplicated gene, themore their nucleotide sequences can have diverged, which mayresult in amino acid differences in the protein products. (a) Basedon that premise, identify which two genes are most divergentfrom each other. What is the percent amino acid identity betweentheir polypeptides? (b) Using the same approach, identify whichtwo globin genes are the most recently duplicated. What is thepercent identity between them?
Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be most similar to each other? [at least mention 2 points]; Why? [at least mention 2 points] Image of the protein sequences :
What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGA