In individuals affected by cystic fibrosis, salt crystals may appear after perspiration dries up. In addition, the disease causes respiratory disorders which can be both debilitating and lethal. It occurs in individuals homozygous for the recessive gene. Two normal parents had a daughter with the symptoms of this disease, and a normal son who marries a normal woman

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter19: Introduction To Genetics

Section: Chapter Questions

Problem 9CT

See similar textbooks

Related questions

Q: 1.What stage of mitosis would be the most likely to stall if there was an issue with the microtubule...

A: Mitosis: it occurs in haploid as well as in diploid cells. It is decided into many phases such as pr...

Q: What will be the role of dentist in preventing antibacterial resistance

A: The ongoing in bacterial resistance is quite high hundreds of thousands of people become resistance ...

Q: A crude extract sample was obtained from a plant and was found effective as an anti-diabetic agent i...

A: Therapeutic index or TI = LD50/ED50 TI basically suggests the relative safety. Now, by putting the v...

Q: Enumerate clinically relevant parasites that can be visualized using the Kato-Katz method in a clini...

A: The most prevalent method of gastrointestinal infection is the contamination of water, food, and han...

Q: 5. Construct a gene map given the following informa Which two genes are most likely going to be inhe...

A: The crossover frequency is a frequency that measures the rate at which crossing over takes place bet...

Q: Thesis statement abut bioethtical issue of euthanasia.

A: The primary criteria for euthanasia was in terms of animal welfare. And that are that the method be ...

Q: Explain the mechanism by which cells sample extracellular fluid.

A: Extracellular fluid refers to bodily fluid that is not contained within cells. It can be present in ...

Q: How has having an opposable thumb helped primates, especially humans, adapt to their environment and...

A: The opposable thumb is an adaptation that helps humans and other primates to carry out the tasks the...

Q: 4. You have determined that the gene order for three linked genes being studied is A B C. The number...

A: The frequency of recombination is a metric of genetic linkage that is used to create a genetic linka...

Q: Sea urchin development. Basic features of the formation of the axes: A-P & L-R and the role of micro...

A: EMT/Ingression - Epithelial mesenchymal transition is a crucial process for placing the mesoderm ben...

Q: Select all the statements that provide evidence that DNA is the genetic material. Check All That App...

A: The eukaryote chromosome is linear and contains both DNA and protein, and both are found in equal ma...

Q: What is terminator structure ?

A: Introduction: When DNA is transcribed into a newly generated string of mRNA, it is translated into p...

Q: In this process of enzyme inhibition, a molecule binds to a site on the enzyme that is NOT the activ...

A: An enzyme inhibitor are molecules that interrupt or decreases the rate of an enzyme catalyzed reacti...

Q: How Small Noncoding RNAs Play Regulatory Roles in Bacteria ?

A: Small RNAs (sRNAs) influence gene expression via base pairing with mRNA after transcription. The int...

Q: What is the most likely order of the linked genes R, S, and T if the distance between R and S is 22 ...

A: A linkage map, also known as a genetic chromosome map, is a linear graphic representation of the seq...

Q: he cuticle is a complex non-cellular layer secreted by the epidermis. It is the seat of complex proc...

A: The main composition of hemolymph in insects is water, other substances includes amino acid, hormone...

Q: Which of the following statement is not false? Cellulose containing foods can be consumed by humans ...

A: Human cannot digest cellulose. But we eat food rich in fiber that makes up plant cell walls. Nucleo...

Q: While investigating the function of a specific growth factor receptor gene from humans, researchers ...

A: Growth factors work by engaging with certain cell surface receptors to control cellular proliferatio...

Q: 5. A cross between two wild-type flies gave progeny all of which were wild type. When vg e flies the...

A: Introduction: Test cross refers to a genetic cross between a homozygous recessive individual and a c...

Q: Which of the following is NOT a defining chordate characteristic? O post-anal tail O vertebrae O pha...

A: Chordate characteristics include presence of notochord, a dorsol hollow nerve cord and paired pharyn...

Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...

A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...

Q: for

A: Generally only about 10%of energy at one level is available to the next level... This loss of energy...

Q: Relate the edaphic factors and Climatic factors with the type and abundance of vegetation and other ...

A: Answer : the edaphic factors which relates to the type and abundance of vegetation and other organis...

Q: What ion and ion channels does a muscle cell have?

A: Muscle is a specialized tissue that arises from the mesodermal layer and aids in an organism's movem...

Q: The endocrine system is composed of glands that secrete hormones that regulate the activity of diffe...

A: The pituitary gland is called the master gland because hormones secreted by it control the activitie...

Q: Myoglobin is a carbohydrate which in normally found in muscle tissue. True False Chromatin is compos...

A: It specifies a single polypeptide chain with one oxygen binding site. Myoglobin has a heme prostheti...

Q: Ray-finned fish Sharks Roderts & ratbts Crocodles Amphibiens Primates Birds Hair Eggs wth shel Amrio...

A: An outgroup in a phylogeny is the most distantly related organism.Here in this phylogeny the outgrou...

Q: What is the protective function of mucus?

Q: What will be the role of dentist in preventing antibacterial resistance?

A: INTRODUCTION Infections are not mainly respond to the antibiotics are called as antibiotic ...

Q: Analyze how human actions affect the health of an environment. Use the lion fish as an example.

A: Introduction Humans have been constantly exploiting the resources of nature in order to fulfil the ...

Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron m...

A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription...

Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force) ...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: An ...

Q: The cornsnake (Pantherophis guttatus) has a recessive allele for pigmentation that causes albinism (...

A: Reptiles are the class of Animals that are cold blooded. They inhabit both, the land and the waters....

Q: They have purified a 1100 bp HindIII restriction fragment that they plan to sequence. As a first ste...

A: EcoR1: EcoR1 is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction...

Q: What type of tissue is the heart made out of

A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...

Q: What is genetic disorders? Explain by giving an example.

A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...

Q: Identify and explain what insects are expected to have the most sclerotized heads? Does an exoskelet...

A: Scelerotin is typically a brown coloured substance found in cuticles of insects. Scelerotin is forme...

Q: In a breed of horse, they can be purebred black (B), purebred white (W) or blue roan (black and whit...

A: horses can have different coat colors. they can have white, black, brown or roan.

Q: Consider the equation below. What are its consequences in the context of an electrophoresis experime...

A: Electrophoresis is a technique used in laboratories to separate DNA, RNA, and protein molecules depe...

Q: Hydrochloric acid is part of chemical digestion? A. True B. False

A: Introduction :- Enzymes are secreted throughout the digestive tract during chemical digestion. The c...

Q: Explain the level of greenhouse gases in the atmosphere and its impacts in environments with a neat ...

A: Green house effect It is the phenomena where earth surface get heated. It is a natural process. when...

Q: PROBLEM The following data were obtained from the thyroid uptake study of a patient after administra...

A: thyroid uptake is the method via which the radiologist determines the thyroid function in the patien...

Q: What is Cot analysis? Do the Cot renaturation curves for a virus, bacterium, and yeast all roughly c...

A: C0t analysis, which is based on the principles of DNA reassociation kinetics, is a biochemical techn...

Q: Why is it best to examine a freshly collected stool sample in clinical parasitology laboratory? ...

A: INTRODUCTION In the Medical Parasitology, the specimen collection is an important part th...

Q: What advantages are there to having genes arranged in an operon, compared with the arrangement in eu...

A: The gene is the basic morphological and physiological unit of heredity. DNA is used to make genes. S...

Q: 1. What is the difference between anaerobic respiration and fermentation?

A: According to Bartleby guidelines , we are supposed to answer first question in case of multiple ques...

Q: Part 1: Identify the haploid and diploid generations of the following plants. (Examples are found in...

A: Ans) ✓Life cycle of bryophytes The life cycle of bryophytes consists of an alternation of two stages...

Q: A 12-year-old boy is brought in by his mother with a 2-day history of fever and generalized weakness...

A: Peeiorbital erythema : skin redness Edema : swelling Opthalmoplegia : abnormal eye movement that o...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: What donates electrons to the photosystems of the light-dependent reactions of photosynthesis? If cy...

A: As per our guidelines, we are supposed to answer only three subparts. Kindly repost the question wit...

Concept explainers

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.

Question

In individuals affected by cystic fibrosis, salt crystals may appear after
perspiration dries up. In addition, the disease causes respiratory disorders
which can be both debilitating and lethal. It occurs in individuals homozygous
for the recessive gene. Two normal parents had a daughter with the
symptoms of this disease, and a normal son who marries a normal woman
with an afflicted A test (salt concentration in perspiration of heterozygotes is
higher than normal) disclosed that both are indeed carriers of the gene. If the
first child born to the mating in (b) was defective, what is the probability that
the 2nd child would also be defective?
Express answer in fraction form

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Familial retinoblastoma, a rare autosomal dominant defect, arose in a large family that had no prior history of the disease. Consider the following pedigree (the darkly colored symbols represent affected individuals): a. Circle the individual(s) in which the mutation most likely occurred. b. Is the person who is the source of the mutation affected by retinoblastoma? Justify your answer. c. Assuming that the mutant allele is fully penetrant, what is the chance that an affected individual will have an affected child?
Achondroplasia is a rare dominant autosomal defect resulting in dwarfism. The unaffected brother of an individual with achondroplasia is seeking counsel on the likelihood of his being a carrier of the mutant allele. What is the probability that the unaffected client is carrying the achondroplasia allele?
In individuals affected by cystic fibrosis, salt crystals may appear afterperspiration dries up. In addition, the disease causes respiratory disorderswhich can be both debilitating and lethal. It occurs in individuals homozygousfor recessive gene. If 2 normal parents had a daughter with the symptoms ofthis disease, and a normal son, what is the probability that he might be acarrier of the recessive gene?Express answer in fraction form.
In humans, a rare dominant disorder known as nail-patella syndromecauses abnormalities in the fingernails, toenails, and kneecaps.Researchers have examined family pedigrees with regard to thisdisorder and have also examined the blood types of individualswithin each pedigree. (A description of blood genotypes is foundin Chapter 4.) In the following pedigree, individuals affected withnail-patella disorder are shown with filled symbols. The genotypeof each individual with regard to ABO blood type is also shown.Does this pedigree suggest any linkage between the gene thatcauses nail-patella syndrome and the gene that causes blood type?
Duchenne muscular dystrophy is sex linked and usuallyaffects only males. Victims of the disease become progressively weaker, starting early in life.a. What is the probability that a woman whose brotherhas Duchenne’s disease will have an affected child?b. If your mother’s brother (your uncle) had Duchenne’sdisease, what is the probability that you have receivedthe allele?c. If your father’s brother had the disease, what is theprobability that you have received the allele?
In retinoblastoma, a mutation in one allele of the RB1 tumorsuppressorgene can be inherited from the germ line, causingan autosomal dominant predisposition to the developmentof eye tumors. To develop tumors, a somatic mutation in thesecond copy of the RB1 gene is necessary, indicating that themutation itself acts as a recessive trait. Given that the firstmutation can be inherited, in what ways can a second mutationalevent occur?
Sickle cell anemia is an autosomal recessive genetic disorder. Because individuals affected bysickle cell anemia have defective hemoglobin proteins, their blood cannot transport oxygenproperly. There appears to be a relationship between the incidence of malaria and sickle cellanemia. Individuals with sickle cell anemia and carriers of the sickle cell allele have someresistance to malaria. Malaria is caused by the parasite Plasmodium and is transmitted amonghumans by mosquitoes.4. If scientists are successful in reducing significantly or eliminating malaria, the best predictionfor what will happen to the allele for sickle cell anemia in the population is that it willa. not be affected by the elimination of malariab. increase as its selective advantage is increasedc. be reduced as its selective advantage is decreasedd. disappear quickly as its selective advantage is increased
Sickle cell anemia is an autosomal recessive genetic disorder. Because individuals affected bysickle cell anemia have defective hemoglobin proteins, their blood cannot transport oxygenproperly. There appears to be a relationship between the incidence of malaria and sickle cellanemia. Individuals with sickle cell anemia and carriers of the sickle cell allele have someresistance to malaria. Malaria is caused by the parasite Plasmodium and is transmitted among humans by mosquitoes. If scientists are successful in reducing significantly or eliminating malaria, the best predictionfor what will happen to the allele for sickle cell anemia in the population is that it willa. not be affected by the elimination of malariab. increase as its selective advantage is increasedc. be reduced as its selective advantage is decreasedd. disappear quickly as its selective advantage is increased
Marfan syndrome is a rare inherited human disorder characterizedby unusually long limbs and digits plus defects in the heart (especially the aorta) and the eyes, among other symptoms. Following isa pedigree for this disorder. Affected individuals are shown withfilled (black) symbols. What type of inheritance pattern do youthink is the most likely?
Galactosemia is a recessive human disease that istreatable by restricting lactose and glucose in the diet.Susan Smithers and her husband are both heterozygous for the galactosemia gene.a. Susan is pregnant with twins. If she hasfraternal (nonidentical) twins, what is theprobability both of the twins will be girls whohave galactosemia?b. If the twins are identical, what is the probabilitythat both will be girls and have galactosemia?For parts (c–g), assume that none of the children isa twin.c. If Susan and her husband have four children, whatis the probability that none of the four will havegalactosemia?d. If the couple has four children, what is the probability that at least one child will have galactosemia?e. If the couple has four children, what is the probability that the first two will have galactosemia andthe second two will not?f. If the couple has three children, what is the probability that two of the children will have galactosemia and one will not, regardless of order?g. If…
Cystic fibrosis (CF) is an autosomal recessive condition triggered by the overproduction of stickymucus that clogs the lungs and pancreas. It is a life-threatening disease, but medical advances helpedthe afflicted to live through adulthood. The mother of Claudia died from cystic fibrosis, but her father was normal and never had anyrelative with CF. Her fiancé, Marcus, turned out to be a carrier of the CF allele. What are the genotypes of Claudia and Marcus? Claudia: ________________________ Marcus: _____________________ They planned to have four children. What is the probability that:a. all children will be normal b. at least two will be normal
A woman who sought genetic counseling is found to be heterozygousfor a chromosomal rearrangement between the second andthird chromosomes. Her chromosomes, compared to those in anormal karyotype, are diagrammed on the next page:(a) This woman is phenotypically normal. Does thissurprise you? Why or why not? Under what circumstancesmight you expect a phenotypic effect of such arearrangement?