Which patient/s may receive blood transfusion from an AB+ donor based on their blood typing profile?       patient B only     patient A only     both patient A and B     neither patient A nor patient B

Q: Which of the following lipid types is the least polar? A. Sphingolipids B. Gangliosides C.…

A: Plants and animals contain lipids as a major component of their cells. Phospholipids, triglycerides,…

Q: Match the following methods of Analysis Fractional analysis, methylation, and periodate oxidation A.…

A: Methods of analysis are different techniques used to analyse a compound for determination of its…

Q: • What happens to the functionality of a denatured enzyme? • How can that result be explained with…

A: Enzymes are biological machines that may catalyze certain processes in the cell. Enzymes catalyze…

Q: In the isolation of metabolites and tests for phytochemicals, why should people dry the leaves in…

A: Phytochemicals are compounds that are produced mostly by plants and have biological activity. Plants…

Q: TRUE or FALSE: Lipids may originate through carbocation-based condensation of thioesters or by…

A: Introduction: Lipids are a heterogeneous group of biomolecules that includes fats, oils, waxes,…

Q: At higher amounts of protein, the Bradford assay is not linear. Consider the plot to the right: what…

A: Bradford assay is used to determine the unknown concentration of proteinbin a sample from standard…

Q: Direct methanol fuel cells (DMFCS) have shown some promise as a viable option for providing "green"…

A: The value of Delta G indicates whether a reaction has a tendency to go forward. From this value, we…

Q: In a reverse phase chromatography set up, the component that yields the lowest Rf value is likely to…

A: Reverse phase chromatography: The chromatographic technique that uses the hydrophobic stationary…

Q: 6. Which of the following is an example for broad substrate specificity? a) Chymotrypsin hydrolyzing…

A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…

Q: What type of control generally involves binding of a repressor protein to a regulatory DNA sequence?…

A: Repressor : DNA binding protein which inhibits the expression of 1 or more genes via the binding to…

Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…

A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…

Q: As the smallest unit of lipids is a glycerol, whereas, the amino acid is the smallest unit for…

A: Introduction: Amino acid is a compound that contains amino and a carboxyl group with a unique side…

Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…

A: Food is the source of macronutrients and micronutrients required for the body. During the process of…

Q: In Lieberman's Test, what should you do to revert the change caused by the addition of water to the…

A: Liebermann's test is a confirmatory test for the detection of a phenol group. It is also employed in…

Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…

A: DNA replication is the particular process by which a specific molecule of DNA is being duplicated.…

Q: . Using electron flow arrows, show electron transfer from nadh to fmn in complex 1 of the electron…

A: The electron transport (ETC) chain is coupled with ATP synthesis. ETC occurs in Cristea…

Q: topic: gel electrophoresis What is the purpose of the running buffer?

A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…

Q: Explain the roles of transamination, oxidative deamination and the urea cycle in amino acid…

A: Transamination and deamination are two very important processes of amino acid degradation. The…

Q: Which of the following statements describes one reason that plant oils are generally healthier for…

A: Plant oils, or vegetable oils, are derived from plant sources. There are three different types of…

Q: Write the metabolism (phase 1 & phase 2) of Phenoxybenzamin

A: Phenoxybenzamine is an alpha-adrenergic antagonist with long duration of action because of longer…

Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…

A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…

Q: Indicate at what step number in the glycolysis pathway the following event occur and why?    a.…

A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.

Q: Determine the vitamin content of the following fruits and vegetables using…

A: Introduction: Vitamins are organic compounds present in food that are needed in minimal amounts for…

Q: Which of the following functions is NOT or cannot be performed by lipids? They can serve as chemical…

A: Answer: Definition: Lipids are the organic, water insoluble compounds. Eg: wax, sterols, oils,…

Q: Biological waxes are composed of ____________________.     glycerol and only one fatty acid…

A: Waxes are a class of lipids and are important from physiological perspective.

Q: The structure below is a ___________.       Sphingomyelin     Phosphocholine ceramide…

A: Lipids are a macro biomolecules made of fatty acid monomers, naturally occurring organic compounds…

Q: In monounsaturated fatty acids, the presence of a double bond is usually found at the position…

A: Depending on the presence of double or single bond the fatty acids are classified as unsaturated and…

Q: A homozygous individual has what allele(s) of a particular gene? Select one: a. 2 dominant or 2…

A: An allele is described as an alternative form or version of a gene. An individual inherits two…

Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False

A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…

Q: 5. Use this figure to summarize how the ATP is used as energy "currency", harnessing some of the…

A: ATP is used as a energy currency due to the presence of two high energy phosphoanhydride bonds…

Q: TRUE or FALSE: Terpenes can be classified as lipids due to its structure that originates from…

A: Terpenes  are the naturally occurring molecules, mostly obtained from the plants. They are…

Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…

A: Aminoacids are the building blocks of proteins that are classified as acidic , basic and Amino acids…

Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…

A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…

Q: What are the structural features of 7N7H (Viperin-like enzyme)? a) Must show 3D structure

A: An enzyme is a biological catalyst. it is usually protein. 'Viperin' is a member of the radical…

Q: Make a flow chart of Protein Digestion, Absorption and Nitrogen Excretion. Indicate the organs,…

A: In process of digestion, complex molecules are converted to simple molecules…

Q: How can contaminants in DNA and RNA samples affect absorbance at 260 and concentration results?

A: Introduction: The rings of the bases in nucleic acids (A, T, G, C, and U) are made up of alternating…

Q: What's the length of the DNA around histone core in a nucleosome? 50 base pairs 146 base pairs 8…

A: Nucleosome:- Histones are responsible for the first level of DNA packing and most basic level of…

Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…

A: Chromatography is an analytical technique for separating components of a mixture

Q: .  Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…

A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…

Q: What is the name of the molecule when glucose is bound to hemoglobin?   a. Glycohemoglobin   b.…

A: Hemoglobin is an iron-containing oxygen-transport metalloprotein located in almost all vertebrate…

Q: What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl-…

A: Fatty acid biosynthesis occurs in the cytoplasm of the cell. Fatty acids are the long-chain…

Q: 4. Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? What happens to…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.

A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…

Q: Consider the typical beta oxidation of linoleic acid (C18:2 ^Δ9, 12): How many ATP are generated in…

A: 117 ATP

Q: Sample pH vs Initial Velocity (AA450/60 seconds) a bo16 0.0014 al0012 0.0008 0.0006 0.0004 0.0002 pH…

A: Enzymes are biological catalysts that are capable of catalysing a reaction by binding to Substrate.…

Q: In eukaryotes, sequences that act as binding sites for proteins which alter the accessibility to RNA…

A: In prokaryotes, transcription and translation occur simultaneously as generation time is 20…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: Is it somehow possible to generate carbohydrate from non-carbohydrate? If yes, how and if no, why?

A: Carbohydrates are organic molecules, which act as the primary source of energy. Glucose is the…

Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…

A: A three letter codon is  a sequence of DNA or RNA that corresponds to a specific amino acid.

Q: What technique can be used to separate amino acids on the basis of their pI values?  (a) Thin-layer…

A: An amino acid is a noramlly an organic chemical. Organic chemicals normally have carbon-hydrogen…