Choose a situation on how an organism (plant/animal) maintains homeostasis.

Q: What is an introduction to immunology and immunopathology?

A: The immune system is comprised of various cellular and humoral elements such as T, B-lymphocytes,…

Q: From the following list, which group  has many members with woody, perennial stems that show annual…

A: Equistem is basically the only genus left of subclass equisetidae. Also this is referred as living…

Q: Of the circled parts, determine which is/are parenchyma cells 3 2

A: Introduction Plant tissue is made up of a group of similar cells that serve a specific purpose for…

Q: Ô https://blackboard.grandview.e.. A 自 D Question Completion Status: 2 points Save Answer QUESTION 5…

A: Fatty acids, that can not be synthesized by our body but they are essential for our good health.…

Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.

A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…

Q: define mutator genes and explain their role in carcinogenesis

A: Carcinogenesis is a multistage and multistep process involving modification and mutation to genes…

Q: How does the evolution of endodermis, lignified cell walls, sclerenchyma, vascular tissues, true…

A: Vascular plants are those plants it causes vascular tissues for the transfer of substances. Vascular…

Q: Which are true about tick-borne bacterial diseases? Select which true O One example is the West Nile…

A: Examples for tick borne bacterial diseases include Lyme disease, Rocky Mountain Spotted  Fever,etc.…

Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides

A: Introduction - A gene is a basic unit of heredity in biology, as well as a sequence of nucleotides…

Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…

A:

Q: Which of the following is NOT true of miRNAs?   A. Pri-miRNAs are processed by Drosha in the…

A: A microRNA, also known as a miRNA, is a single-stranded, non-coding RNA molecule that is very small.…

Q: Examining Table 20-5, how would the interpretation ofthe McDonald–Kreitman test results differ if…

A: Ans. The synonymous mutation is silent mutation, which non-synonymous mutation change the nucleotide…

Q: What is the ecological significance of the diatoms? The brown algae?

A: Brown algae are algae that belong to the class Phaeophyceae and due to their brown color, they are…

Q: A 43 year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…

A: option d is the correct answer.

Q: Which of the following applies to quaternary structure? It has two alpha and two beta subunits O a.…

A: Quaternary structure can be spotted in proteins consisting of two or more identical or different…

Q: Why is the nickname "dark reactions" not entirely correct for the chemical stage of photosynthesis?

A: Introduction - 6CO2 + 6H2O = C6H12O6 + 6O2 is a typical representation of photosynthesis. This…

Q: Body organisation in Hydra is of- (A) Tissue grade (B) Organ grade (C) Cellular grade (D) Organ…

A: Introduction - Hydra is a phylum Cnidaria and class Hydrozoa genus of microscopic freshwater…

Q: Pathopysiology for imperforated anus

A: Introduction Pathophysiology:- It is a deranged function in an individual or an organ due to…

Q: g food spoilage. In the last 20 years, food prices ha and the United States Department of…

A: Answer :: 1. Causes of food spoilage and food poisoning.What is Food Spoilage?Food spoilage is…

Q: Iron deficiency results in- (A) Leaf tip necrosis (B) Small leaves disease (C) Decreased protein…

A: Introduction - Iron is a key component of electron chains and a cofactor in a number of important…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Leech obtains continuous blood flow from its victim by pouring in it- (A) Heparin (B) Hirudin (C)…

A: Introduction - Leeches are parasitic or predatory worms with segmented bodies that belong to the…

Q: The Centers for Disease Control and Prevention considers antibioticresistance to be one of the…

A: The best way to fight antibiotic resistance is to never let it happen. It means that we have to use…

Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…

A: There are number of processes necessary for the continuation of generation , growth and…

Q: What are the criteria for selecting organisms to perform crosses to study the inheritance of a few…

A: Introduction - When someone dies, they leave behind private property, titles, debts, entitlements,…

Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…

A: Pollution: Pollution is referred as undesirable change in the biological characteristics of water,…

Q: What is NADP and NADPH?

A: Cofactors Cofactors are the inorganic non-protein molecules or ions that are necessary for the…

Q: Question 88 How is a child with Type I diabetes similar to a child who is starving? Mark all that…

A:

Q: Increased neutrophil cell counts

A: Neutrophils: Neutrophils are the most abundant type of granulocytes and white blood cells in most…

Q: 2.) One experimental tool used in the biological research and in clinical settings is called…

A: FACS/  Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry, which…

Q: 2 Fraternal twins are nonidentical siblings that form wheen two eggs mature, are released, and are…

A: FSH is also known as Follicle Stimulating Hormone. In women, FSH helps manage the menstrual cycle…

Q: of В C

A:

Q: You have counted a total of 6.4 x 10° cells /ml in preparation for plating cells at a concentration…

A: The answer is  1.17 mL of cells and 3.83 mL of medium

Q: (a) Which would be easier to prepare bacterial smear from, liquid or solid culture? Why? (b) Aside…

A: Introduction A bacterial smear is a small layer of bacteria that has been stained on a slide. A…

Q: Why is Cyanotic heart disease important to know ?

A: Introduction The heart is a an organ that circulates blood throughout your body. It is your…

Q: Give 10 sentences about the concept of Epidemiologic lever.

A:

Q: Derive an explanation of a human genetic disorder.

A: A genetic disorder the kind of disorder that is due to the mutation in a single gene. Mutations are…

Q: Which of the following statements about "leak channels" in the plasma mem- brane is correct? A.…

A: Introduction - The sodium ions concentration inside the cell is low, while the sodium ions…

Q: QUESTION 50 Expression of the maternal vs paternal alleles for the Igf2 gene is determined by: O…

A: 50. Expression of the maternal vs paternal allele for the Igf2 gene is determine byimprinting…

Q: Robert Koch (a) proposed a set of guidelines to demonstrate that a specific pathogen causes specific…

A: Microorganisms are small living organisms some of which are pathogenic and cause diseases.

Q: Three mechanisms by which membrane-bind-ing proteins bend a membrane are illustrated in…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: Sam was found to be heterozygous for sickle-cell (Ss) trait. The alleles represented by the letters…

A: Sickle cell is the most common form of abnormal haemoglobins. It occurs due to missense mutation in…

Q: Photosynthesis is the most important producer of molecular oxygen (02) on our planet. From which…

A: To explain: To explain about photosynthesis, the molecules involved, and the destination of the…

Q: The human axial skeleton includes O A. Femur (thigh) O B. ossicle OC TIbia & Fibula (Leg) O D.…

A: The skeletal system is your body's central framework. It consists of bones and connective tissue,…

Q: Explain how each of the following is a signaling molecule, an effector molecule or an adaptor…

A: Introduction :- Ligands, a broad name for compounds that bind selectively to other molecules, are…

Q: What are the divisions of white light according to the electromagnetic spectrum? Which are the two…

A: The white light is made up of seven colors spread between the wavelength of 400 nm to 780 nm. This…

Q: How does intermittent fasting relate to carbohydrates, lipids, proteins, nucleic acids, enzymes etc.…

A: Intermittent fasting (IF) is a term used to describe a variety of eating patterns in which no or few…

Q: 5. View the protists blood parasites (Trypanosoma cruzi, Trypanosoma brucei, and Plasmodium vivax).…

A: Trypanosomes are zooflagellate protozoans that are obligate parasites that can cause parasitic…

Q: Preventon and Control Infective Mode of Definitive Body Host HUMANS INTESTINE Third Common Disease…

A: Answer

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Homeostasis

Homeostasis is a self-regulatory process through which different biological systems maintain constant internal environmental conditions to compensate for environmental changes. In human physiology, it is a process of self-regulating internal, chemical, and physical conditions at an optimal level for survival. The stability through homeostasis can be attained through dynamic equilibrium, in which there is a continuous change until it reaches its systemic conditions.